Previous Contig 003056:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011E10Sequence615003056 (19)sp|P48980|BGAL_LYCES1e-44Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS023B11Sequence599003056 (19)sp|P48980|BGAL_LYCES6e-59Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS025D10Sequence615003056 (19)sp|P48980|BGAL_LYCES4e-43Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS029G03Sequence639003056 (19)gb:LES012796_1684461e-105Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772
JMFS039H02Sequence653003056 (19)sp|P48980|BGAL_LYCES2e-54Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS054C10Sequence627003056 (19)sp|P48980|BGAL_LYCES3e-72Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS066E01Sequence627003056 (19)sp|P48980|BGAL_LYCES1e-59Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS075G01Sequence632003056 (19)sp|P48980|BGAL_LYCES3e-71Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS076B08Sequence627003056 (19)sp|P48980|BGAL_LYCES2e-49Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS080E02Sequence618003056 (19)gb:LES012796_16844614e-71Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772
JMFS081B12Sequence627003056 (19)sp|P48980|BGAL_LYCES9e-63Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS084G06Sequence608003056 (19)sp|P48980|BGAL_LYCES5e-60Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS086E02Sequence625003056 (19)gb:LES012796_16844612e-97Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772
JMFS087H06Sequence613003056 (19)gb:LES012796_16844612e-90Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772
JMFS125F01Sequence564003056 (19)sp|P48980|BGAL_LYCES5e-38Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS131C05Sequence616003056 (19)gb:LES012796_16844612e-90Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772
JMFS138C01Sequence617003056 (19)gb:LES012796_16844611e-97Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772
JMFS143B02Sequence625003056 (19)sp|P48980|BGAL_LYCES1e-61Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)
JMFS156F01Sequence619003056 (19)sp|P48980|BGAL_LYCES8e-46Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029G03+ ACATCACCCATGGAACACCGGTGCGNAGATTTAGAGCCAT
JMFS138C01+ CAT
JMFS086E02+ CAT
                      ____________________________________________________________
consensus ACATCACCCATGGAACACCGGTGCGNAGATTTAGAGCCAT
 
. : . : . : . : . : . :
JMFS029G03+ TTTCGCTGCCCACTGTGCATAAGCATGACCAGGTGCACCAAGTACATATTCCATCGGTCC
JMFS138C01+ TTTCGCTGCCCACTGTGCATAAGCATGACCAGGTGCACCAAGTACATATTCCATCGGTCC
JMFS086E02+ TTTCGCTGCCCACTGTGCATAAGCATGACCAGGTGCACCAAGTACATATTCCATCGGTCC
JMFS087H06+ GCACCAAGTACATATTCCATCGGTCC
JMFS131C05+ GCACCAAGTACATATTCCATCGGTCC
                      ____________________________________________________________
consensus TTTCGCTGCCCACTGTGCATAAGCATGACCAGGTGCACCAAGTACATATTCCATCGGTCC
 
. : . : . : . : . : . :
JMFS029G03+ ATATTCGTTCTCAATCTGGGATAAGATTATAGGGCCACCCTGAGATTCATACAGCCTTTC
JMFS138C01+ ATATTCGTTCTCAATCTGGGATAAGATTATAGGGCCACCCTGAGATTCATACAGCCTTTC
JMFS086E02+ ATATTCGTTCTCAATCTGGGATAAGATTATAGGGCCACCCTGAGATTCATACAGCCTTTC
JMFS087H06+ ATATTCGTTCTCAATCTGGGATAAGATTATAGGGCCACCCTGAGATTCATACAGCCTTTC
JMFS131C05+ ATATTCGTTCTCAATCTGGGATAAGATTATAGGGCCACCCTGAGATTCATACAGCCTTTC
                      ____________________________________________________________
consensus ATATTCGTTCTCAATCTGGGATAAGATTATAGGGCCACCCTGAGATTCATACAGCCTTTC
 
. : . : . : . : . : . :
JMFS029G03+ TGATTTCATCATGTTAACAATCATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS138C01+ TGATTTCATCATGTTAACAATCATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS086E02+ TGATTTCATCATGTTAACAATCATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS087H06+ TGATTTCATCATGTTAACAATCATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS131C05+ TGATTTCATCATGTTAACAATCATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS080E02+ TGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS054C10+ ATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
JMFS075G01+ AATCATGGTTGTGAATTTNTGCATTGCGGCCTTGAAAGGTCC
                      ____________________________________________________________
consensus TGATTTCATCATGTTAACAATCATGGTTGTGAATTTTTGCATTGCGGCCTTGAAAGGTCC
 
. : . : . : . : . : . :
JMFS029G03+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS138C01+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS086E02+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS087H06+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS131C05+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS080E02+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS054C10+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS075G01+ ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS084G06+ GAACATACTTCAGCCAAACTGGANAGCCCCCAAA
JMFS023B11+ TCAGCCAAACTGGAAAGCCCCCAAA
JMFS081B12+ GATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS066E01+ CCCTGGAACATACTTCAGCCAAACTGGANAGCCCNCAAA
JMFS143B02+ TGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
JMFS039H02+ AAGCCCCCAAA
                      ____________________________________________________________
consensus ATTGTCTGTTCTGAAACTGATCCCTGGAACATACTTCAGCCAAACTGGAAAGCCCCCAAA
 
. : . : . : . : . : . :
JMFS029G03+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS138C01+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS086E02+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS087H06+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS131C05+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS080E02+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS054C10+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS075G01+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS084G06+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS023B11+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS081B12+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS066E01+ GTTCCATTCACCACAAGCATAAGGCCCCACTATGAGATGAACATANAGTCCAGCTTGATG
JMFS143B02+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS076B08+ AGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS039H02+ GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
JMFS011E10+ ATGAACATAAAGTCCAGCTTGATG
JMFS156F01+ GAGATGAACATAAAGTCCAGCTTGATG
JMFS025D10+ AAGTCCAGCTTGATG
                      ____________________________________________________________
consensus GTTCCATTCACCACAAGCATAAGGCCCCACTCTGAGATGAACATAAAGTCCAGCTTGATG
 
. : . : . : . : . : . :
JMFS029G03+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS138C01+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS086E02+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS087H06+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS131C05+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS080E02+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS054C10+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS075G01+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS084G06+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS023B11+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS081B12+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS066E01+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS143B02+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS076B08+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS039H02+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCNCAGGTTG
JMFS011E10+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCNCAGGTTG
JMFS156F01+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS125F01+ AAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
JMFS025D10+ AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
                      ____________________________________________________________
consensus AACCAGCTTAATGAATTTCACAAGATCATACCTTTCCTCAAAATAATACTTCCCAGGTTG
 
. : . : . : . : . : . :
JMFS029G03+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS138C01+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS086E02+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS087H06+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS131C05+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS080E02+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS054C10+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS075G01+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS084G06+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS023B11+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS081B12+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS066E01+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCCTCTTTTGC
JMFS143B02+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS076B08+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS039H02+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS011E10+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS156F01+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS125F01+ AGGTTCATGCCCATTCCAGAAAACATATGTTTGAATCACATCCAACCCTCCTTCTTTTGC
JMFS025D10+ AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
                      ____________________________________________________________
consensus AGGTTCATGCCCATTCCAGAAAACATATGTCTGAATCACATCCAACCCTCCTTCTTTTGC
 
. : . : . : . : . : . :
JMFS029G03+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS138C01+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS086E02+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS087H06+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS131C05+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS080E02+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS054C10+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS075G01+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS084G06+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS023B11+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS081B12+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS066E01+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS143B02+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS076B08+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS039H02+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS011E10+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS156F01+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS125F01+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
JMFS025D10+ TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
                      ____________________________________________________________
consensus TTTCTGAATAAGATCTGGCCACATCTCAGGGGTGCTTCTTGGGTAGTGAATAGAACCAGA
 
. : . : . : . : . : . :
JMFS029G03+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS138C01+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS086E02+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS087H06+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS131C05+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS080E02+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS054C10+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS075G01+ AATAAGAATATTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS084G06+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS023B11+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS081B12+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS066E01+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS143B02+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS076B08+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS039H02+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS011E10+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS156F01+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS125F01+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
JMFS025D10+ AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
                      ____________________________________________________________
consensus AATAAGAATCTTTCTTTGGCCATTCACAATTATAGCATTCCTATCATACGACACTGAAGC
 
. : . : . : . : . : . :
JMFS029G03+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCA
JMFS138C01+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS086E02+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS087H06+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS131C05+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS080E02+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS054C10+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS075G01+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS084G06+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS023B11+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS081B12+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS066E01+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS143B02+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS076B08+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS039H02+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS011E10+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS156F01+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS125F01+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
JMFS025D10+ ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
                      ____________________________________________________________
consensus ATTCCCACAACAAAACCATGAACACAGCAGCAGCATCCCCACCGCCAAAACAAGTTTCAG
 
. : . : . : . : . : . :
JMFS138C01+ TCCCATGTTTTC
JMFS086E02+ TCCCATGTTTTCCTATGTTGTC
JMFS087H06+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGG
JMFS131C05+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAA
JMFS080E02+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS054C10+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS075G01+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS084G06+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS023B11+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS081B12+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS066E01+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS143B02+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS076B08+ TCCCATGTTTTCCTATGTTGTCTCAAGATTTTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS039H02+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS011E10+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS156F01+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS125F01+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
JMFS025D10+ TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
                      ____________________________________________________________
consensus TCCCATGTTTTCCTATGTTGTCTCAAGATTCTGTGCCCTTTACAAGGCAATGCCTCTTTA
 
. : . : . : . : . : . :
JMFS080E02+ TACTCGAACCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS054C10+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS075G01+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS084G06+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS023B11+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS081B12+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS066E01+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS143B02+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS076B08+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS039H02+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS011E10+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS156F01+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS125F01+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
JMFS025D10+ TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
                      ____________________________________________________________
consensus TACTCGACCCTTATTCTTTTTTTTGAAGATATACTCGACCCTTATTCTTCTGCACTATAC
 
. : . : . : . : . : . :
JMFS080E02+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGT
JMFS054C10+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTC
JMFS075G01+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCC
JMFS084G06+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS023B11+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS081B12+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS066E01+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS143B02+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS076B08+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS039H02+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS011E10+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS156F01+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS125F01+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
JMFS025D10+ TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
                      ____________________________________________________________
consensus TCTATGCTTCTTTGAAAATTGGGTCTGGCCAAGAAAGCAGCTAGCGTTCCTGTTTTTGCT
 
. : . : . : . : . : . :
JMFS084G06+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTC
JMFS023B11+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTC
JMFS081B12+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCT
JMFS066E01+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTA
JMFS143B02+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTAT
JMFS076B08+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
JMFS039H02+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
JMFS011E10+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
JMFS156F01+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
JMFS125F01+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
JMFS025D10+ CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
                      ____________________________________________________________
consensus CTCTTGAGAAAAGAGAAATGAGATTTTCTCTCTCTCTCTCTCTCTTTATGTATGTATTTT
 
. : . : . : . : . : . :
JMFS076B08+ GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGA
JMFS039H02+ GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGA
JMFS011E10+ GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGAGTG
JMFS156F01+ GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGAGTG
JMFS125F01+ GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGAGTG
JMFS025D10+ GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGAGTGGTTTAATGGGAAGTT
                      ____________________________________________________________
consensus GATTCTCTTTTTCTAAAGTACAATGTACAAATTAACTACTGAGTGGTTTAATGGGAAGTT