Previous Contig 003055:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023N22Sequence436003055 (5)pir|D96836|D968361e-53probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005777009327 (3)gb:AY496707_16091239e-46Pandanus amaryllifolius glycerol kinase (GK) mRNA, complete cds.
JMFS014E09Sequence406003055 (5)pir|D96836|D968363e-57probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005
JMFS025D08Sequence620003055 (5)pir|D96836|D968364e-72probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005
JMSF014I14Sequence551003055 (5)pir|D96836|D968364e-74probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005796009327 (3)gb:AY496707_16091234e-47Pandanus amaryllifolius glycerol kinase (GK) mRNA, complete cds.
JMSF041K15Sequence715003055 (5)pir|D96836|D96836e-101probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005750009327 (3)pir|D96836|D968361e-89probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS014E09+ CTGGGGCGTTCAACATTCTTAACACAG
                      ____________________________________________________________
consensus CTGGGGCGTTCAACATTCTTAACACAG
 
. : . : . : . : . : . :
JMFS014E09+ GTGAGAAGACAATTTTTGGTAAAATCTCCGCAGGAATTCCCAATAACTCCAGCGTTGGCT
JMSF041K15+ ACTCCAGCGTTGGNT
                      ____________________________________________________________
consensus GTGAGAAGACAATTTTTGGTAAAATCTCCGCAGGAATTCCCAATAACTCCAGCGTTGGCT
 
. : . : . : . : . : . :
JMFS014E09+ TATCCCAATCCAGAGTTTTAAGATTCATCAACATAGTCCTCGACGCATTAGACACATCAG
JMSF041K15+ TATCCCAATCCAGAGTTTTAAGATTCATCAACATAGTCCTNGACGCATTAGACACATCAG
                      ____________________________________________________________
consensus TATCCCAATCCAGAGTTTTAAGATTCATCAACATAGTCCTCGACGCATTAGACACATCAG
 
. : . : . : . : . : . :
JMFS014E09+ TGACGTGTAAACCTTTCCCCACCCCTCCCGTCATGTTCCATATCAGCCAGGTGTCAATAG
JMSF041K15+ TGACGTGTAAACCTTTCCCCACCCCTCCCGTCATGTTCCATATCAGCCAGGTGTCAATAG
                      ____________________________________________________________
consensus TGACGTGTAAACCTTTCCCCACCCCTCCCGTCATGTTCCATATCAGCCAGGTGTCAATAG
 
. : . : . : . : . : . :
JMFS014E09+ TTCCAAACAGCGCATCCCCGTTCTTCACTGCTTCCTTAACAGCCTCCACATTCTCCAACA
JMSF014I14+ TTCACTGCTTCCTTAACAGCCTCCACATTCTCCAACA
JMSF041K15+ TTCCAAACAGCGCATCCCCGTTCTTCACTGCTTCCTTAACAGCCTCCACATTCTCCAACA
JMFS025D08+ AGCCTCCACATTCTCCAACA
                      ____________________________________________________________
consensus TTCCAAACAGCGCATCCCCGTTCTTCACTGCTTCCTTAACAGCCTCCACATTCTCCAACA
 
. : . : . : . : . : . :
JMFS014E09+ ACCACAACAGCTTCATTGCACTAAAGTAAGTGCTTATCGGCAAACCACATGTCTCAACAA
JMSF014I14+ ACCACAACAGCTTCATTGCACTAAAGTAAGTGCTTATCGGCAAACCACATGTCTCAACAA
JMSF041K15+ ACCACAACAGCTTCATTGCACTAAAGTAAGTGCTTATCGGCAAACCACATGTCTCAACAA
JMFS025D08+ ACCACAACAGCTTCATTGCACTAAAGTAAGTGCTTATCGGCAAACCACATGTCTCAACAA
                      ____________________________________________________________
consensus ACCACAACAGCTTCATTGCACTAAAGTAAGTGCTTATCGGCAAACCACATGTCTCAACAA
 
. : . : . : . : . : . :
JMFS014E09+ AATGAGTTCTCCCGCCTGGTAATTCTTTCTCCAACTTTCTGCAGATGGAGGTAGTGCGAG
JMSF014I14+ AATGAGTTCTCCCGCCTGGTAATTCTTTCTCCAACTTTCTGCAGATGGAGGTAGTGCGAG
JMSF041K15+ AATGAGTTCTCCCGCCTGGTAATTCTTTCTCCAACTTTCTGCAGATGGAGGTAGTGCGAG
JMFF023N22+ TCTTTCTCCAACTTTCTGCAGATGGAGGTAGTGCGAG
JMFS025D08+ AATGAGTTCTCCCGCCTGGTAATTCTTTCTCCAACTTTCTGCAGATGGAGGTAGTGCGAG
                      ____________________________________________________________
consensus AATGAGTTCTCCCGCCTGGTAATTCTTTCTCCAACTTTCTGCAGATGGAGGTAGTGCGAG
 
. : . : . : . : . : . :
JMFS014E09+ CGTCCATCCAAACAATAGC
JMSF014I14+ CGTCCATCCAAACAATAGCGTTGTAGAGAGGAAGCCCTGAGGATTTGCTCCAAACCACAG
JMSF041K15+ CGTCCATCCAAACAATAGCGTTGTAGAGAGGAAGCCCTGAGGATTTGCTCCAAACCACAG
JMFF023N22+ CGTCCATCCAAACAATAGCGTTGTAGAGAGGAAGCCCTGAGGATTTGCTCCAAACCACAG
JMFS025D08+ CGTCCATCCAAACAATAGCGTTGTAGAGAGGAAGCCCTGAGGATTTGCTCCAAACCACAG
                      ____________________________________________________________
consensus CGTCCATCCAAACAATAGCGTTGTAGAGAGGAAGCCCTGAGGATTTGCTCCAAACCACAG
 
. : . : . : . : . : . :
JMSF014I14+ TGGTCTCTCTCTGGTTGGTGATACCAATGGCTTTGAGTAAGCGGCCGACGTTGTGGCCAT
JMSF041K15+ TGGTCTCTCTCTGGTTGGTGATACCAATGGCTTTGAGTAAGCGGCCGACGTTGTGGCCAT
JMFF023N22+ TGGTCTCTCTCTGGTTGGTGATACCAATGGCTTTGAGTAAGCGGCCGACGTTGTGGCCAT
JMFS025D08+ TGGTCTCTCTCTGGTTGGTGATACCAATGGCTTTGAGTAAGCGGCCGACGTTGTGGCCAT
                      ____________________________________________________________
consensus TGGTCTCTCTCTGGTTGGTGATACCAATGGCTTTGAGTAAGCGGCCGACGTTGTGGCCAT
 
. : . : . : . : . : . :
JMSF014I14+ CGGCGGTGGCCTTGTCGACTGCCTTGGAAACACAGACCTTCACACTCTCCAGAATCTCCA
JMSF041K15+ CGGCGGTGGCCTTGTCGACTGCCTTGGAAACACAGACCTTCACACTCTTCAGAATCTCCA
JMFF023N22+ CGGCGGTGGCCTTGTCGACTGCCTTGGAAACACAGACCTTCACACTCTCCAGAATCTCCA
JMFS025D08+ CGGCGGTGGCCTTGTCGACTGCCTTGGAAACACAGACCTTCACACTCTCCAGAATCTCCA
                      ____________________________________________________________
consensus CGGCGGTGGCCTTGTCGACTGCCTTGGAAACACAGACCTTCACACTCTCCAGAATCTCCA
 
. : . : . : . : . : . :
JMSF014I14+ CCGGATCATGCTCCACCCATCCGGCCTGGGGGTAGAACTGGGTGAACTCGATCTGGTGCG
JMSF041K15+ CCGGATCATGCTCCACCCATCCGGCCTGGGGGTAGAACTGGGTGAACTCGATCTGGTGCG
JMFF023N22+ CCGGATCATGCTCCACCCATCCGGCCTGGGGGTAGAACTGGGTGAACTCGATCTGGTGCG
JMFS025D08+ CCGGATCATGCTCCACCCATCCGGCCTGGGGGTAGAACTGGGTGAACTCGATCTGGTGCG
                      ____________________________________________________________
consensus CCGGATCATGCTCCACCCATCCGGCCTGGGGGTAGAACTGGGTGAACTCGATCTGGTGCG
 
. : . : . : . : . : . :
JMSF014I14+ ATACAACAGGTCGGGCGGAACGGTCGTAGATGATGAAGCGGGTGCTGGTTGTGCCTTGAT
JMSF041K15+ ATACAACAGGTCGGGCGGAACGGTCGTAGATGATGAAGCGGGTGCTGGTTGTGCCTTGAT
JMFF023N22+ ATACAACAGGTCGGGCGGAACGGTCGTAGATGATGAAGCGGGTGCTGGTTGTGCCTTGAT
JMFS025D08+ ATACAACAGGTCGGGCGGAACGGTCGTAGATGATGAAGCGGGTGCTGGTTGTGCCTTGAT
                      ____________________________________________________________
consensus ATACAACAGGTCGGGCGGAACGGTCGTAGATGATGAAGCGGGTGCTGGTTGTGCCTTGAT
 
. : . : . : . : . : . :
JMSF014I14+ CAATGGAGCCGACGAACACTTGTTCTTCCTTAGACATTTTTCTTTCTCCTTCTTCTCTGG
JMSF041K15+ CAATGGAGCCGACGAACACTTGTTCTTCCTTAGACATTTTTCTTTCTCCTTCTTCTCTGG
JMFF023N22+ CAATGGAGCCGACGAACACTTGTTCTTCCTTAGACATTTTTCTTTCTCCTTCTTCTCTGG
JMFS025D08+ CAATGGAGCCGACGAACACTTGTTCTTCCTTAGACATTTTTCTTTCTCCTTCTTCTCTGG
                      ____________________________________________________________
consensus CAATGGAGCCGACGAACACTTGTTCTTCCTTAGACATTTTTCTTTCTCCTTCTTCTCTGG
 
. : . : . : . : . : . :
JMSF014I14+ TGTGGATACAATTCGCGCTCTGGCGATGAGTCT
JMSF041K15+ TGTGGATACAATTCGCGCTCTGGCGATGAGTCT
JMFF023N22+ TGTGGATACAATTCGCGCTCTGGCGATGAGTCT
JMFS025D08+ TGTGGATACAATTCGCGCTCTGGCGATGAGTCTAAGGTTGCAACGAGGGAGTGTCGTGTT
                      ____________________________________________________________
consensus TGTGGATACAATTCGCGCTCTGGCGATGAGTCTAAGGTTGCAACGAGGGAGTGTCGTGTT
 
. : . : . : . : . : . :
JMFS025D08+ GACTTATATGCTTTGAAAATTGAAATCCCAATTCTTGGAATCTTTAGAAAATGCAGTTGG
                      ____________________________________________________________
consensus GACTTATATGCTTTGAAAATTGAAATCCCAATTCTTGGAATCTTTAGAAAATGCAGTTGG