Previous Contig 003054:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS025D06Sequence623003054 (5)gb:AK118751_18167133e-55Arabidopsis thaliana At1g60860 mRNA for putative GCN4-complementing protein, com
JMFS073C07Sequence622003054 (5)gb:AK118751_18167133e-56Arabidopsis thaliana At1g60860 mRNA for putative GCN4-complementing protein, com
JMFS100B03Sequence627003054 (5)pir|A96634|A966343e-81probable GCN4-complementing protein F23C21.2 [imported] - Arabidopsis thaliana>g
JMFS117H01Sequence584003054 (5)gb:AK118751_18167133e-56Arabidopsis thaliana At1g60860 mRNA for putative GCN4-complementing protein, com
JMSF048A21Sequence689003054 (5)gb:AC018908_15384368e-69Arabidopsis thaliana chromosome 1 BAC T7P1 genomic sequence, complete sequence.685024291pir|A96634|A966343e-46probable GCN4-complementing protein F23C21.2 [imported] - Arabidopsis thaliana>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS100B03+ TCATGTCCCAACTTAAAGTATCTTAGGTGAGCATCCATAATTGCACTAAAAGATTCCAA
                      ____________________________________________________________
consensus TCATGTCCCAACTTAAAGTATCTTAGGTGAGCATCCATAATTGCACTAAAAGATTCCAA
 
. : . : . : . : . : . :
JMFS100B03+ AAACTCGTGCTTCTTTCTTGCCTCAACATTCATGAGAGCATTTACTAAATTAAAGCGGCT
JMSF048A21+ CTCAACATTCATGAGAGCATTTACTAAATTAAAGCGGCT
                      ____________________________________________________________
consensus AAACTCGTGCTTCTTTCTTGCCTCAACATTCATGAGAGCATTTACTAAATTAAAGCGGCT
 
. : . : . : . : . : . :
JMFS100B03+ TCTTTCAAAAGCTGACTTTGAATTGTGTAGGTCTTCTTCGAGTTCAGTAATAACATCATC
JMSF048A21+ TCTTTCAAAAGCTGACTTTGAATTGTGTAGGTCTTCTTCGAGTTCAGTAATAACATCATC
JMFS117H01+ TCGAGTTCAGTAATAACATCATC
JMFS073C07+ TCGAGTTCAGTAATAACATCATC
JMFS025D06+ TCGAGTTCAGTAATAACATCATC
                      ____________________________________________________________
consensus TCTTTCAAAAGCTGACTTTGAATTGTGTAGGTCTTCTTCGAGTTCAGTAATAACATCATC
 
. : . : . : . : . : . :
JMFS100B03+ GCGTGTACTCTTCTTTAACGAGGCAAACTTTTCACGTGCCTGGTCATAAGCAGTTGTTGC
JMSF048A21+ GCGTGTACTCTTCTTTAACGAGGCAAACTTTTCACGTGCCTGGTCATAAGCAGTTGTTGC
JMFS117H01+ GCGTGTACTCTTCTTTAACGAGGCAAACTTTTCACGTGCCTGGTCATAAGCAGTTGTTGC
JMFS073C07+ GCGTGTACTCTTCTTTAACGAGGCAAACTTTTCACGTGCCTGGTCATAAGCAGTTGTTGC
JMFS025D06+ GCGTGTACTCTTCTTTAACGAGGCAAACTTTTCACGTGCCTGGTCATAAGCAGTTGTTGC
                      ____________________________________________________________
consensus GCGTGTACTCTTCTTTAACGAGGCAAACTTTTCACGTGCCTGGTCATAAGCAGTTGTTGC
 
. : . : . : . : . : . :
JMFS100B03+ TTTGTCAAATCTGCGACGAGATTCCTTGACATCTTGAAGACCAACAGACAAAAGTTCAGT
JMSF048A21+ TTTGTCAAATCTGCGACGAGATTCCTTGACATCTTGAAGACCAACAGACAAAAGTTCAGT
JMFS117H01+ TTTGTCAAATCTGCGACGAGATTCCTTGACATCTTGAAGACCAACAGACAAAAGTTCAGT
JMFS073C07+ TTTGTCAAATCTGCGACGAGATTCCTTGACATCTTGAAGACCAACAGACAAAAGTTCAGT
JMFS025D06+ TTTGTCAAATCTGCGACGAGATTCCTTGACATCTTGAAGACCAACAGACAAAAGTTCAGT
                      ____________________________________________________________
consensus TTTGTCAAATCTGCGACGAGATTCCTTGACATCTTGAAGACCAACAGACAAAAGTTCAGT
 
. : . : . : . : . : . :
JMFS100B03+ CAAGCGATCAACAAGTACATGCTCCACCTGAGAACGGAGAAGTTCCTTATATGTAGCAAG
JMSF048A21+ CAAGCGATCAACAAGTACATGCTCCACCTGAGAACGGAGAAGTTCCTTATATGTAGCAAG
JMFS117H01+ CAAGCGATCAACAAGTACATGCTCCACCTGAGAACGGAGAAGTTCCTTATATGTAGCAAG
JMFS073C07+ CAAGCGATCAACAAGTACATGCTCCACCTGAGAACGGAGAAGTTCCTTATATGTAGCAAG
JMFS025D06+ CAAGCGATCAACAAGTACATGCTCCACCTGAGAACGGAGAAGTTCCTTATATGTAGCAAG
                      ____________________________________________________________
consensus CAAGCGATCAACAAGTACATGCTCCACCTGAGAACGGAGAAGTTCCTTATATGTAGCAAG
 
. : . : . : . : . : . :
JMFS100B03+ CTCTCGAAATGCAGAAACAAATTTTGACATGATTGGGCCTCCAATTGACACACTGAGAGG
JMSF048A21+ CTCTCGAAATGCAGAAACAAATTTTGACATGATTGGGCCTCCAATTGACACACTGAGAGG
JMFS117H01+ CTCTCGAAATGCAGAAACAAATTTTGACATGATTGGGCCTCCAATTGACACACTGAGAGG
JMFS073C07+ CTCTCGAAATGCAGAAACAAATTTTGACATGATTGGGCCTCCAATTGACACACTGAGAGG
JMFS025D06+ CTCTCGAAATGCAGAAACAAATTTTGACATGATTGGGCCTCCAATTGACACACTGAGAGG
                      ____________________________________________________________
consensus CTCTCGAAATGCAGAAACAAATTTTGACATGATTGGGCCTCCAATTGACACACTGAGAGG
 
. : . : . : . : . : . :
JMFS100B03+ ATCGTCGTGACCTCCACCGAATACCTCCAATGAATCTGCAAAGATATTGTCACCATTGTG
JMSF048A21+ ATCGTCGTGACCTCCACCGAATACCTCCAATGAATCTGCAAAGATATTGTCACCATTGTG
JMFS117H01+ ATCGTCGTGACCTCCACCGAATACCTCCAATGAATCTGCAAAGATATTGTCACCATTGTG
JMFS073C07+ ATCGTCGTGACCTCCACCGAATACCTCCAATGAATCTGCAAAGATATTGTCACCATTGTG
JMFS025D06+ ATCGTCGTGAACTCCACCGAATACCTCCAATGAATCTGCAAAGATATTGTCACCATTGTG
                      ____________________________________________________________
consensus ATCGTCGTGACCTCCACCGAATACCTCCAATGAATCTGCAAAGATATTGTCACCATTGTG
 
. : . : . : . : . : . :
JMFS100B03+ TGCTTCTCCAAGAGTGTCAGTGTATTTCTTACACCCCTTGTATAGCTTATGGCAGCGGTC
JMSF048A21+ TGCTTCTCCAAGAGTGTCAGTGTATTTCTTACACCCCTTGTATAGCTTATGGCAGCGGTC
JMFS117H01+ TGCTTCTCCAAGAGTGTCAGTGTATTTCTTACACCCCTTGTATAGCTTATGGCAGCGGTC
JMFS073C07+ TGCTTCTCCAAGAGTGTCAGTGTATTTCTTACACCCCTTGTATAGCTTATGGCAGCGGTC
JMFS025D06+ TGCTTCTCCAAGAGTGTCAGTGTATTTCTTACACCCCTTGTATAGCTTATGGCAGCGGTC
                      ____________________________________________________________
consensus TGCTTCTCCAAGAGTGTCAGTGTATTTCTTACACCCCTTGTATAGCTTATGGCAGCGGTC
 
. : . : . : . : . : . :
JMFS100B03+ TCTCAGCTCATCTGTAGTATGTTCCAAAGATCTCACTTGTTTATGGAACATAGGAGAATC
JMSF048A21+ TCTCAGCTCATCTGTAGTATGTTCCAAAGATCTCACTTGTTTATGGAACATAGGAGAATC
JMFS117H01+ TCTCAGCTCATCTGTAGTATGTTCCAAAGATCTCACTTGTTTATGGAACATAGGAGAATC
JMFS073C07+ TCTCAGCTCATCTGTAGTATGTTCCAAAGATCTCACTTGTTTATGGAACATAGGAGAATC
JMFS025D06+ TCTCAGCTCATCTGTAGTATGTTCCAAAGATCTCACTTGTTTATGGAACATAGGAGAATC
                      ____________________________________________________________
consensus TCTCAGCTCATCTGTAGTATGTTCCAAAGATCTCACTTGTTTATGGAACATAGGAGAATC
 
. : . : . : . : . : . :
JMFS100B03+ CTCCAACTTCATAAACGCAGCCATTCTG
JMSF048A21+ CTCCAACTTCATAAACGCAGCCATTCTGCTGTGTCTGAGAGCTACAGGGAAGTTTAGTTT
JMFS117H01+ CTCCAACTTCATAAACGCAGCCATTCTGCTGTGTCTGAGAGCTACAGGGAAGTTTAGTTT
JMFS073C07+ CTCCAACTTCATAAACGCAGCCATTCTGCTGTGTCTGAGAGCTACAGGGAAGTTTAGTTT
JMFS025D06+ CTCCAACTTCATAAACGCAGCCATTCTGCTGTGTCTGAGAGCTACAGGGAAGTTTAGTTT
                      ____________________________________________________________
consensus CTCCAACTTCATAAACGCAGCCATTCTGCTGTGTCTGAGAGCTACAGGGAAGTTTAGTTT
 
. : . : . : . : . : . :
JMSF048A21+ CAGAGTTTCAGATCGAGATATGGAGATGGAGCATGCTGTCATGGGCTTTTATGTCATTTG
JMFS117H01+ CAGAGTTTCAGATCGAGATATGGAGATGGAGCATGCTGTCATGGGCTTTTATGTCATTTG
JMFS073C07+ CAGAGTTTCAGATCGAGATATGGAGATGGAGCATGCTGTCATGGGCTTTTATGTCATTTG
JMFS025D06+ CAGAGTTTCAGATCGAGATATGGAGATGGAGCATGCTGTCATGGGCTTTTATGTCATTTG
                      ____________________________________________________________
consensus CAGAGTTTCAGATCGAGATATGGAGATGGAGCATGCTGTCATGGGCTTTTATGTCATTTG
 
. : . : . : . : . : . :
JMSF048A21+ GATGCCACCGCTGGCTCGTCATTCGTCAATCTCATTATAATAAAATTTC
JMFS117H01+ GATGCCACCGCTGGCTCGTCA
JMFS073C07+ GATGCCACCGCTGGCTCGTCATTCGTCAATCTCATTATAATAAAATTTCAAGTGTTCCA
JMFS025D06+ GATGCCACCGCTGGCTCGTCATTCGTCAATCTCATTATAATAAAATTTCAAGTGTTCCAC
                      ____________________________________________________________
consensus GATGCCACCGCTGGCTCGTCATTCGTCAATCTCATTATAATAAAATTTCAAGTGTTCCAC