Previous Contig 003035:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS023G01Sequence551003035 (2)pir|T45910|T459108e-08hypothetical protein F4P12.400 - Arabidopsis thaliana>gb:AX544409_1470112 Sequen
JMFS023G02Sequence571003035 (2)pir|T45910|T459104e-11hypothetical protein F4P12.400 - Arabidopsis thaliana>gb:AX544409_1470112 Sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS023G02+ ATCATCCAAGACTCTCCTCATCGCATCAAAA
JMFS023G01+ TCGCATCAAAA
                      ____________________________________________________________
consensus ATCATCCAAGACTCTCCTCATCGCATCAAAA
 
. : . : . : . : . : . :
JMFS023G02+ GATCCCGCTTTTCCAAGCTTACGGAGAATCTCCTCGCAAATCTGCCGACTGGGTTCAATC
JMFS023G01+ GATCCCGCTTTTCCAAGCTTACGGAGAATCTCCTCGCAAATCTGCCGATTGGGTTCAATC
                      ____________________________________________________________
consensus GATCCCGCTTTTCCAAGCTTACGGAGAATCTCCTCGCAAATCTGCCGATTGGGTTCAATC
 
. : . : . : . : . : . :
JMFS023G02+ TCAGGCTGCTCTAAAGCCCATTTAAAGAGGTTAAGAGCTGAGGCTTCATCTTTCTCCTGA
JMFS023G01+ TCAGGCTGCTCTAAAGCCCATTTAAAGAGGTTAAGAGCTGAGGCTTCATCTTTCTCCTGA
                      ____________________________________________________________
consensus TCAGGCTGCTCTAAAGCCCATTTAAAGAGGTTAAGAGCTGAGGCTTCATCTTTCTCCTGA
 
. : . : . : . : . : . :
JMFS023G02+ CGAAGAGTATCCAGAAGCTGCTTCTGGGTGAAGTCTGGTGGGAGGTGTTTGGATTTGAGG
JMFS023G01+ GGAAGAGTATCCAGAAGCTGCTTCTGGGTGAAGTCTGGTGGGAGGTGTTTGGATTTGAGG
                      ____________________________________________________________
consensus GGAAGAGTATCCAGAAGCTGCTTCTGGGTGAAGTCTGGTGGGAGGTGTTTGGATTTGAGG
 
. : . : . : . : . : . :
JMFS023G02+ AGTGAAATTGTGGCGGCAGAGGGTGAATTTGTGGCCGAGATTGAGGCAAAGAGCTCACGG
JMFS023G01+ AGTGAAATTGTGGCGGCAGAGGGTGAATTTGTGGCCGAGATTGAGGCAAAGAGCTCACGG
                      ____________________________________________________________
consensus AGTGAAATTGTGGCGGCAGAGGGTGAATTTGTGGCCGAGATTGAGGCAAAGAGCTCACGG
 
. : . : . : . : . : . :
JMFS023G02+ CGTTGTGATAATGTGAAAGAAATGAGCTTTTGAGAGTTTAAGGATATGGTAAAAGGGAAC
JMFS023G01+ CGTTGTGATAATGTGAAAGAAATGAGCTTTTGAGAGTTTAAGGATATGGTAAAAGGGAAC
                      ____________________________________________________________
consensus CGTTGTGATAATGTGAAAGAAATGAGCTTTTGAGAGTTTAAGGATATGGTAAAAGGGAAC
 
. : . : . : . : . : . :
JMFS023G02+ GCATTTACAAAGCATGATGAGACACCCATTGATGCAATTCAACAAGCATGTAGCATGCAA
JMFS023G01+ GCATTTACAAAGCATGATGAGACACCCATTGATGCAATTCAACAAGCATGTAGCATGCAA
                      ____________________________________________________________
consensus GCATTTACAAAGCATGATGAGACACCCATTGATGCAATTCAACAAGCATGTAGCATGCAA
 
. : . : . : . : . : . :
JMFS023G02+ TATCAAAGTCTGGATAGAAACTTATACCTTAGCTCGAGATATTTGCACATACAGCCAAAT
JMFS023G01+ TATCAAAGTCTGGATAGAAACTTATACCTTAGCTCGAGATATTTGCACATACAGCCAAAT
                      ____________________________________________________________
consensus TATCAAAGTCTGGATAGAAACTTATACCTTAGCTCGAGATATTTGCACATACAGCCAAAT
 
. : . : . : . : . : . :
JMFS023G02+ CAGTAGAGGACAGTGAAGGGTGTTGTGGTGCAACACAGAAGAATTCAATTGCAGGTGATA
JMFS023G01+ CAGTAGAGGACAGTGAAGGGTGTTGTGGTGCAACACAGAAGAATTCAATTGCAGGTGATA
                      ____________________________________________________________
consensus CAGTAGAGGACAGTGAAGGGTGTTGTGGTGCAACACAGAAGAATTCAATTGCAGGTGATA
 
. : . : . : . : . : . :
JMFS023G02+ CTGAAAAGTGAAAACTGCGATTCTTTAATGGGTGGTTTTGTCATGGATAAGAAAGTGAGC
JMFS023G01+ CTGAAAAGTGAAAACTGCGATTCTTTAATGGGTGGTTTTGTCATGGATAAGAAAGTGAGC
                      ____________________________________________________________
consensus CTGAAAAGTGAAAACTGCGATTCTTTAATGGGTGGTTTTGTCATGGATAAGAAAGTGAGC