Previous Contig 003017:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS021F02Sequence615003017 (7)gb:AY058845_15643823e-50Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A
JMFS047C05Sequence627003017 (7)gb:AY058845_15643826e-55Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A
JMFS156F05Sequence626003017 (7)gb:AY058845_15643821e-56Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A
JMSF004C21Sequence377003017 (7)gb:AY058845_15643824e-26Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A
JMSF009G23Sequence302003017 (7)gb:AY058845_15643827e-18Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A717011298 (5)gb:AP003436_18293621e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P047
JMSF027B16Sequence665003017 (7)gb:AY058845_15643824e-56Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A761011298 (5)gb:AP003436_18293627e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P047
JMSF042N21Sequence788003017 (7)gb:AY058845_15643821e-70Arabidopsis thaliana AT4g21150/F7J7_90 mRNA, complete cds.>gb:AY079034_1568147 A648011298 (5)gb:AP003436_18293621e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042N21+ GGACTATTGATGATGATGCTGAAAGAGGACCCTGATGTCCATGTGCATCAACAAGNTTC
                      ____________________________________________________________
consensus GGACTATTGATGATGATGCTGAAAGAGGACCCTGATGTCCATGTGCATCAACAAGNTTC
 
. : . : . : . : . : . :
JMSF042N21+ TCATCAAAATAATAGGCTCCATCATCATATCTCTCAATGCCATCAAAAAGCTTTGATACA
                      ____________________________________________________________
consensus TCATCAAAATAATAGGCTCCATCATCATATCTCTCAATGCCATCAAAAAGCTTTGATACA
 
. : . : . : . : . : . :
JMFS156F05+ TGGAAGATGCTAATGAAACAACG
JMSF042N21+ TCATTTTTAAACGTATCAATCAGAGAATACTCAATCTTGGAAGATGCTAATGAAACAACG
JMFS047C05+ ACG
JMSF027B16+ GCTAATGAAACAACG
                      ____________________________________________________________
consensus TCATTTTTAAACGTATCAATCAGAGAATACTCAATCTTGGAAGATGCTAATGAAACAACG
 
. : . : . : . : . : . :
JMFS156F05+ CCAGCAAGGGTCTCAAGCGCTATTC---CTGCAGCATAATAGCTAGACTCAGGATTATTG
JMSF042N21+ CCAGCAAGGGTCTCAAGCGCTATTC---CTGCAGCATAATAGCTAGACTCAGGATTATTG
JMFS047C05+ CCAGCAAGGGTCTCAAGCGCTATTC---NTGCAGCATAATAGCTAGACTCAGGATTATTA
JMSF027B16+ CCAGCAAGGGTCTCAAGCGCTATTCCTGCTGCAGCATAATAGCTAGACTCAGGATTATTA
JMFS021F02+ TAGACTCAGGATTATTA
                      ____________________________________________________________
consensus CCAGCAAGGGTCTCAAGCGCTATTC---CTGCAGCATAATAGCTAGACTCAGGATTATTA
 
. : . : . : . : . : . :
JMFS156F05+ GAATTATAACGCCACCTTCCATCACTTTGGCTGAGAGCCTTGATTGAATGGAAAAATCCT
JMSF042N21+ GAATTATAACGCCACCTTCCATCACTTTGGCTGAGAGCCTTGATTGAATGGAAAAATCCT
JMFS047C05+ GAATTATAACGCCATCTTCCATCACTTTGGCTGAGAGCCTTGATTGAATGGAAAACTCCT
JMSF027B16+ GAATTATAACGCCATCTTCCATCACTTTGGCTGAGAGCCTTGATTGAATGGAAAACTCCT
JMFS021F02+ GAATTATAACGCCATCTTCCATCACTTTGGCTGAGAGCCTTGATTGAATGGAAAACTCCT
                      ____________________________________________________________
consensus GAATTATAACGCCATCTTCCATCACTTTGGCTGAGAGCCTTGATTGAATGGAAAACTCCT
 
. : . : . : . : . : . :
JMFS156F05+ TTAGCATCTTTGAGATGAACATCAACTTCAGAACTCAGATCCTTGATAAGCACCAACCCT
JMSF042N21+ TTAGCATCTTTGAGATGAACATCAACTTCAGAACTCAGATCCTTGATAAGCACCAACCCT
JMFS047C05+ TTAGCATCTTTGAGATGAACATCAACTTCAGAACTCAGATCCTTGATAAGCACCAAACCT
JMSF027B16+ TTAGCATCTTTGAGATGAACATCAACTTCAGAACTCAGATCCTTGATAAGCACCAAACCT
JMFS021F02+ TTAGCATCTTTGAGATGAACATCAACTTCAGAACTCAGATCCTTGATAAGCACCAAACCT
                      ____________________________________________________________
consensus TTAGCATCTTTGAGATGAACATCAACTTCAGAACTCAGATCCTTGATAAGCACCAAACCT
 
. : . : . : . : . : . :
JMFS156F05+ CCTATTGAATAGTAGAAGTCAAGAAGTGATTTGGCGCTATTTACACCTTCTTTGAGTCTT
JMSF042N21+ CCTATTGAATAGTAGAAGTCAAGAAGTGATTTGGCGCTATTTACACCTTCTTTGAGTCTT
JMFS047C05+ CCTATTGAATAGTAGAAGTCAAGAAGTGATTTGGCGCTATTTACACCTTCGTTGAGTCTT
JMSF004C21+ GTCTT
JMSF027B16+ CCTATTGAATAGTAGAAGTCAAGAAGTGATTTGGCGCTATTTACACCTTCGTTGAGTCTT
JMFS021F02+ CCTATTGAATAGTAGAAGTCAAGAAGTGATTTGGCGCTATTTACACCTTCGTTGAGTCTT
                      ____________________________________________________________
consensus CCTATTGAATAGTAGAAGTCAAGAAGTGATTTGGCGCTATTTACACCTTCGTTGAGTCTT
 
. : . : . : . : . : . :
JMFS156F05+ GAGGCAGTGCGTGCAATAACCCCATCATTCAGCTCACACTTTAATATTCCATTAACTCTG
JMSF042N21+ GAGGCAGTGCGTGCAATAACCCCATCATTCAGCTCACACTTTAATATTCCATTAACTCTG
JMFS047C05+ GAGGCAGTGGGTGCAATAACCCCATCATTCTGCTCACACTTTAATATTCCATTAACTCTG
JMSF004C21+ GAGGCAGTGCGTGCAATAACCCCATCATTCAGCTCACACTTTAATATTCCATTAACTCTG
JMSF027B16+ GAGGCAGTGGGTGCAATAACCCCATCATTCTGCTCACACTTTAATATTCCATTAACTCTG
JMFS021F02+ GAGGCAGTGGGTGCAATAACCCCATCATTCTGCTCACACTTTAATATTCCATTAACTCTG
                      ____________________________________________________________
consensus GAGGCAGTGGGTGCAATAACCCCATCATTCTGCTCACACTTTAATATTCCATTAACTCTG
 
. : . : . : . : . : . :
JMFS156F05+ AATGCTTGAAACAAATCCTTTAAGTGCGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
JMSF042N21+ AATGCTTGAAACAAATCCTTTAAGTGCGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
JMFS047C05+ AATGCTTGAAACAAATCCTTCAAGTGTGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
JMSF004C21+ AATGCTTGAAACAAATCCTTTAAGTGCGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
JMSF009G23+ AGGAGTCGATAGAATGTCAACAACTGAC
JMSF027B16+ AATGCTTGAAACAAATCCTTCAAGTGTGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
JMFS021F02+ AATGCTTGAAACAAATCCTTCAAGTGTGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
                      ____________________________________________________________
consensus AATGCTTGAAACAAATCCTTTAAGTGTGAAGAAGGAGTCGATAGAATGTCAACAACTGAC
 
. : . : . : . : . : . :
JMFS156F05+ TTACAGGTGGAACCCTTTATTTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
JMSF042N21+ TTACAGGTGGAACCCTTTATTTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
JMFS047C05+ TTACAGGTGGAAGCCTTTATGTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
JMSF004C21+ TTACAGGTGGAACCCTTTATTTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
JMSF009G23+ TTACAGGTGGAACCCTTTATTTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
JMSF027B16+ TTACAGGTGGAAGCCTTTATGTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
JMFS021F02+ TTACAGGTGGAAGCCTTTATGTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
                      ____________________________________________________________
consensus TTACAGGTGGAACCCTTTATTTCAGCCTTTTTATCAATCCCGAGGACATCAAACGTTCTC
 
. : . : . : . : . : . :
JMFS156F05+ AAAGCCTCATAGGTTTCTTCTAAGCTCCCAAAAGATCCATCGGAGATAGTAAAGAGCTCT
JMSF042N21+ AAAGCCTCATAGGTTTCTTCTAAGCTCCCAAAAGATCCATCGGAGATAGTAAAGAGCTCT
JMFS047C05+ AAAGCCTCATAGGTTTCTTCCAGGCTCCCATAAGATCCGTCGGAGGGAGTAAAGAGCTCT
JMSF004C21+ AAAGCCTCATAGGTTTCTTCTAAGCTCCCAAAAGATCCATCGGAGATAGTAAAGAGCTCT
JMSF009G23+ AAAGCCTCATAGGTTTCTTCTAAGCTCCCAAAAGATCCATCGGAGATAGTAAAGAGCTCT
JMSF027B16+ AAAGCCTCATAGGTTTCTTCCAGGCTCCCATAAGATCCGTCGGAGGGAGTAAAGAGCTCT
JMFS021F02+ AAAGCCTCATAGGTTTCTTCCAGGCTCCCATAAGATCCGTCGGAGGGAGTAAAGAGCTCT
                      ____________________________________________________________
consensus AAAGCCTCATAGGTTTCTTCTAAGCTCCCAAAAGATCCATCGGAGATAGTAAAGAGCTCT
 
. : . : . : . : . : . :
JMFS156F05+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGATCGCAGCTCCGCAGATCGAC
JMSF042N21+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGATCGCAGCTCCGCAGATCGAC
JMFS047C05+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGACCGCAGCTCCACAGATCGAC
JMSF004C21+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGATCGCAGCTCCGCAGATCGAC
JMSF009G23+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGATCGCAGCTCCGCAGATCGAC
JMSF027B16+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGACCGCAGCTCCACAGATCGAC
JMFS021F02+ AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGACCGCAGCTCCACAGATCGAC
                      ____________________________________________________________
consensus AATGCAGCGGATCGATGAGAGTCGGAGATCGGCCTGAAGATCGCAGCTCCGCAGATCGAC
 
. : . : . : . : . : . :
JMFS156F05+ ACGATTGTTAACGCTATTACAATGACAAATCCTAATTTTATCGCCATTCTTTTTTGGGAG
JMSF042N21+ ACGATTGTTAACGCTATTACAATGACAAATCCTAATTTTATCGCCATTCTTTTTTGGGAG
JMFS047C05+ AAAATTGTCAATGCTATTACAATGACAAATCCTAATTTTATCGCCATTC-CTTTTGGGAG
JMSF004C21+ ACGATTGTTAACGCTATTACAATGACAAATCCTAATTTTATCGCCATTCTTTTTTGGGAG
JMSF009G23+ ACGATTGTTAACGCTATTACAATGACAAATCCTAATTTTATCGCCATTCTTTTTTGGGAG
JMSF027B16+ AAAATTGTCAATGCTATTACAATGACAAATCCTAATTTTATCGCCATTC-CTTTTGGGAG
JMFS021F02+ AAAATTGTCAATGCTATTACAATGACAAATCCTAATTTTATCGCCATTC-CTTTTGGGAG
                      ____________________________________________________________
consensus ACGATTGTTAACGCTATTACAATGACAAATCCTAATTTTATCGCCATTCTTTTTTGGGAG
 
. : . : . : . : . : . :
JMFS156F05+ AGAAGA
JMSF042N21+ AGAAGACTACC
JMFS047C05+ AGAAGACTACC-AGTCCGCGCCAGAGTGA
JMSF004C21+ AGAAGACTACC
JMSF009G23+ AGAAGACTACCAAGTCCGCGCCAGTGTGA
JMSF027B16+ AGAAGACTACC-AGTCCGCGCCAGAGTGACTGCAACGTCTAGTTTACATC
JMFS021F02+ AGAAGACTACC-AGTCCGCGCCAGAGTGACTGCAACGTCTAGTTTACATCTGACTGTTCT
                      ____________________________________________________________
consensus AGAAGACTACC-AGTCCGCGCCAGAGTGACTGCAACGTCTAGTTTACATCTGACTGTTCT