Previous Contig 003014:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS013D03Sequence581003014 (10)gb:LES308542_16845672e-75Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS021C11Sequence613003014 (10)gb:LES308542_16845671e-68Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS036B05Sequence583003014 (10)gb:LES308542_16845679e-73Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS039A10Sequence624003014 (10)gb:LES308542_16845675e-76Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS097H09Sequence603003014 (10)gb:LES308542_16845678e-74Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS106G10Sequence608003014 (10)gb:LES308542_16845678e-74Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS147H06Sequence627003014 (10)gb:LES308542_16845677e-87Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMFS151H09Sequence623003014 (10)gb:LES308542_16845672e-81Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMSF032E20Sequence690003014 (10)gb:LES308542_16845672e-85Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).713012828 (2)gb:LES308542_16845671e-74Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).
JMSF040B13Sequence641003014 (10)gb:LES308542_16845674e-76Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).803012828 (2)gb:LES308542_16845678e-96Lycopersicon esculentum mRNA for insulin degrading enzyme (ide gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS147H06+ TGTATCCCAACTTCCTGTGCTGAACTTATGGTACGGATGATC
JMFS151H09+ CTGAACTTATGGTACGGATGATC
JMFS039A10+ CTGAACTTATGGTACGGATGATC
JMSF032E20+ CCCAACTTCCTGTGCTGAACTTATGGTACGGATGATC
                      ____________________________________________________________
consensus TGTATCCCAACTTCCTGTGCTGAACTTATGGTACGGATGATC
 
. : . : . : . : . : . :
JMFS147H06+ TTCTGCACTAAGATGTTTGTGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS106G10+ TGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS013D03+ ATGTTTGTGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMSF040B13+ ACTAAGATGTTTGTGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS151H09+ TTCTGCACTAAGATGTTTGTGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS039A10+ TTCTGCACTAAGATG-TTGTGAAGCTGGTTAATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS036B05+ GTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS097H09+ TGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMSF032E20+ TTCTGCACTAAGATGTTTGTGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
JMFS021C11+ AGAGTAGATTCTT
                      ____________________________________________________________
consensus TTCTGCACTAAGATGTTTGTGAAGCTGGTTCATTCTCCAACCATCAGAGAGTAGATTCTT
 
. : . : . : . : . : . :
JMFS147H06+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS106G10+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS013D03+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMSF040B13+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS151H09+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS039A10+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS036B05+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS097H09+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMSF032E20+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
JMFS021C11+ TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
                      ____________________________________________________________
consensus TCGGTGTTCAGAATCAACAGCTTTAATTTCTCTCATAGTAGCATCCGGTGACATCAGTGG
 
. : . : . : . : . : . :
JMFS147H06+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS106G10+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS013D03+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMSF040B13+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS151H09+ ATTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS039A10+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS036B05+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS097H09+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMSF032E20+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
JMFS021C11+ CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
                      ____________________________________________________________
consensus CTTGATGAAGAACTGTGCAAACCTGTCCAAGGCTTCTTCAAAACAATCAGTGTTAACATC
 
. : . : . : . : . : . :
JMFS147H06+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS106G10+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS013D03+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMSF040B13+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS151H09+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS039A10+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS036B05+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS097H09+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMSF032E20+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
JMFS021C11+ AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
                      ____________________________________________________________
consensus AAAGAAGTAGTTTGTGTGCTCAGAAGAAGTAAAAGCATTTGTACTGCCTCCATGCTCTGT
 
. : . : . : . : . : . :
JMFS147H06+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS106G10+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS013D03+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMSF040B13+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS151H09+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS039A10+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS036B05+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS097H09+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMSF032E20+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
JMFS021C11+ GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
                      ____________________________________________________________
consensus GATATACTTTGAGTAACTATCTTCCTTGGGATACTTCTCACTTGCATAAAACAGCATATG
 
. : . : . : . : . : . :
JMFS147H06+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS106G10+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS013D03+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMSF040B13+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS151H09+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS039A10+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS036B05+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS097H09+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMSF032E20+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
JMFS021C11+ CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
                      ____________________________________________________________
consensus CTCTAGGAAATGGGCAAGGCCTTCAAGACCCTTTGGATCGCTAAAGGCACCAACCCCAAC
 
. : . : . : . : . : . :
JMFS147H06+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS106G10+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS013D03+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMSF040B13+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS151H09+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS039A10+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS036B05+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS097H09+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMSF032E20+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
JMFS021C11+ ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
                      ____________________________________________________________
consensus ATCCATGGAAGCAGCACACTTATCAGTTTCAGGATCGCTGATGAGAAGGACCTCCAGAGA
 
. : . : . : . : . : . :
JMFS147H06+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS106G10+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS013D03+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMSF040B13+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS151H09+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS039A10+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS036B05+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS097H09+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMSF032E20+ ATTTGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
JMFS021C11+ ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
                      ____________________________________________________________
consensus ATTCGGAAGCACGATTCTTCTGTACTCCCGTTTGTCCGTTCGAGGCTTCGTTATCTCAAC
 
. : . : . : . : . : . :
JMFS147H06+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS106G10+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS013D03+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMSF040B13+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS151H09+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS039A10+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS036B05+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS097H09+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMSF032E20+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
JMFS021C11+ CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
                      ____________________________________________________________
consensus CACATCTTCCCTCTTTCCAACCGCCATTCTCTTCCTCCACTGCCGTCAACGCCTAATTGG
 
. : . : . : . : . : . :
JMFS147H06+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGA
JMFS106G10+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMFS013D03+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAA
JMSF040B13+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMFS151H09+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMFS039A10+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMFS036B05+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMFS097H09+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMSF032E20+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
JMFS021C11+ ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
                      ____________________________________________________________
consensus ATACTTTATATGTGTGTATTCTGTAATTCTATATGTATCTATAGAGAGAGAAATGAGGAA
 
. : . : . : . : . : . :
JMFS106G10+ GAGGATGAATAGAGGACTGTGGTTCTT
JMSF040B13+ GAGGATGAATAGAGGACTGTGGTTCTTTCTTTCTTGGTATTGACTT
JMFS039A10+ GA
JMFS036B05+ GAGGATGAAT
JMFS097H09+ GAGGATGAATAGAGGACTGTGG
JMSF032E20+ GAGGATGAATAGAGGACTGTGGTTCTTTCTTTCTTGGTATTGACTT
JMFS021C11+ GAGGATGAATAGAGGACTGTGGTTCTTTCTTTCTTGGTATTGACTTGAGGATTGGGATTA
                      ____________________________________________________________
consensus GAGGATGAATAGAGGACTGTGGTTCTTTCTTTCTTGGTATTGACTTGAGGATTGGGATTA