Previous Contig 003011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008D01Sequence611003011 (8)pir|T04047|T040472e-88isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMFS018G01Sequence503003011 (8)pir|T04047|T040471e-81isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMFS021A08Sequence615003011 (8)pir|T04047|T040472e-90isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMFS052C12Sequence634003011 (8)pir|T04047|T04047e-104isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMFS146D02Sequence627003011 (8)pir|T04047|T04047e-105isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMSF031G18Sequence634003011 (8)pir|T04047|T040472e-91isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15579011320 (2)pir|T04047|T040476e-18isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMSF038H21Sequence697003011 (8)pir|T04047|T04047e-107isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15
JMSF041H15Sequence835003011 (8)pir|T04047|T04047e-126isoleucine-tRNA ligase homolog F24G24.120 - Arabidopsis thaliana>gb:ATCHRIV29_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041H15+ CCACATA
                      ____________________________________________________________
consensus CCACATA
 
. : . : . : . : . : . :
JMSF041H15+ GATTTTCCCATCAAACTTGTTGCGAACCTTTAGATACACAAAATTAGCATTCACACAAAG
                      ____________________________________________________________
consensus GATTTTCCCATCAAACTTGTTGCGAACCTTTAGATACACAAAATTAGCATTCACACAAAG
 
. : . : . : . : . : . :
JMSF041H15+ AGCAAGATTACTAGGAAGAGTCCATGGAGTCGTCGTCCAAGCAACAAAAGATGCACCGTC
                      ____________________________________________________________
consensus AGCAAGATTACTAGGAAGAGTCCATGGAGTCGTCGTCCAAGCAACAAAAGATGCACCGTC
 
. : . : . : . : . : . :
JMFS146D02+ AGATACCATGATTTCAGGATCAGGAACTTCCTTGTAATT
JMFS052C12+ CTTGTAATT
JMSF038H21+ ATGGGGAAAGATACCATGATTTCAGGATCAGGAACTTCCTTGTAATT
JMSF041H15+ TTGATCATCAACTATGGGGAAAGATACCATGATTTCAGGATCAGGAA----CTTGTAATT
                      ____________________________________________________________
consensus TTGATCATCAACTATGGGGAAAGATACCATGATTTCAGGATCAGGAACTTCCTTGTAATT
 
. : . : . : . : . : . :
JMFS146D02+ TGAATNTGCTTCAAAATTGGATAATGGAGTTTTGCAACCCGTGCTATATGGCATAACCTT
JMFS052C12+ TGAATTGNCTTCAAAATTGGATAATGGAGTTTTGCAACCCGTGCTATATGGCATAACCTT
JMSF038H21+ TGAATTTGCTTCAAAATTGGATAATGGAGTTTTGCAACCCGTGCTATATGGCATAACCTT
JMSF031G18+ TTGGATAATGGAGTTTTGCAACCCGTGCTATATGGCATAACCTT
JMSF041H15+ TGAATTTGCTTCAAAATTGGATAATGGAGTTTTGCAACCCGTGCTATATGGCATAACCTT
JMFS008D01+ CTT
JMFS021A08+ ATATGGCATAACCTT
                      ____________________________________________________________
consensus TGAATTTGCTTCAAAATTGGATAATGGAGTTTTGCAACCCGTGCTATATGGCATAACCTT
 
. : . : . : . : . : . :
JMFS146D02+ GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMFS052C12+ GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMSF038H21+ GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMSF031G18+ GAAGCCTCTATACACAAGTCCCTNGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMSF041H15+ GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMFS018G01+ AAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMFS008D01+ GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
JMFS021A08+ GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
                      ____________________________________________________________
consensus GAAGCCTCTATACACAAGTCCCTTGTCAAACAACTGAGCAAAGACCCACCAGACGCTCTC
 
. : . : . : . : . : . :
JMFS146D02+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMFS052C12+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMSF038H21+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMSF031G18+ CATGAACTTCAAATCCATAGTCTNGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMSF041H15+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMFS018G01+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMFS008D01+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
JMFS021A08+ CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
                      ____________________________________________________________
consensus CATGAACTTCAAATCCATAGTCTTGTAATCGTCTCTGAAATCAATCCAGCGCCCCATCCT
 
. : . : . : . : . : . :
JMFS146D02+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMFS052C12+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMSF038H21+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMSF031G18+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMSF041H15+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMFS018G01+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMFS008D01+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
JMFS021A08+ GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
                      ____________________________________________________________
consensus GACCACAGTCTTCTCCCACTCCGCAACGTACCGGGTCACAATCCCCCGGCACTCCTCGTT
 
. : . : . : . : . : . :
JMFS146D02+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMFS052C12+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMSF038H21+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMSF031G18+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMSF041H15+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMFS018G01+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMFS008D01+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
JMFS021A08+ GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
                      ____________________________________________________________
consensus GTACTTGTCAATGCCCATCTTAATCACATCCTCGCGGCTCTTAATCCCAAGCTTCTTATC
 
. : . : . : . : . : . :
JMFS146D02+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMFS052C12+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMSF038H21+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMSF031G18+ GATCTCGTGCTNGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMSF041H15+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMFS018G01+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMFS008D01+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
JMFS021A08+ GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
                      ____________________________________________________________
consensus GATCTCGTGCTCGACAGGAAGGCCGTGGCAGTCCCATCCGAACCGTCGAGTGACGTGGTG
 
. : . : . : . : . : . :
JMFS146D02+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMFS052C12+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMSF038H21+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMSF031G18+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMSF041H15+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMFS018G01+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMFS008D01+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
JMFS021A08+ GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
                      ____________________________________________________________
consensus GCCGGCCATGGACTGGTACCGAGTGACGATATCCTTGATCGTCCCGGCGAGGATATGGCC
 
. : . : . : . : . : . :
JMFS146D02+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
JMFS052C12+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
JMSF038H21+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
JMSF031G18+ GTAGTGCGGCAGACCTGTAGNGAAAGGCGGGCCGTCATAGAAGATATANTCCGGCATATC
JMSF041H15+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
JMFS018G01+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
JMFS008D01+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
JMFS021A08+ GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
                      ____________________________________________________________
consensus GTAGTGCGGCAGACCTGTAGCGAAAGGCGGGCCGTCATAGAAGATATACTCCGGCATATC
 
. : . : . : . : . : . :
JMFS146D02+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMFS052C12+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMSF038H21+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMSF031G18+ TTTCGTCCGGTCTAGNTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMSF041H15+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMFS018G01+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMFS008D01+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
JMFS021A08+ TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
                      ____________________________________________________________
consensus TTTCGTCCGGTCTAGCTGAGTCTTGAAGGCCTTGACTTCATCCCACCATTGAAGGATTCT
 
. : . : . : . : . : . :
JMFS146D02+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATC
JMFS052C12+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
JMSF038H21+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
JMSF031G18+ CTCCTCNTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
JMSF041H15+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
JMFS018G01+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGC
JMFS008D01+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
JMFS021A08+ CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
                      ____________________________________________________________
consensus CTCCTCCTGCTTGGGGAAGGAGAAATCTTTGCCCTCGCATACATCATCCATAGCAAGCTG
 
. : . : . : . : . : . :
JMFS052C12+ TTCTGTA
JMSF038H21+ TTCTGTAGTGGTGGTGTACGCGGGCAATGTAAGCTGTAAGAACTTCACT
JMSF031G18+ TTCTGTAGTGGTGGTGTACGCGGGCAATGTAAGCTGTAAGAACTTCACT
JMSF041H15+ TTCTGTAGTGGTGGTGTACGCGGGCAATGTAAGCTGTAAGAACTTCACT
JMFS008D01+ TTCTGTAGTGGTGGTGTACGCGGGCAATGTAAGCTGTAAGAA
JMFS021A08+ TTCTGTAGTGGTGGTGTACGCGGGCAATGTAAGCTGTAAGAACTTCACTGTGTTGTAGAA
                      ____________________________________________________________
consensus TTCTGTAGTGGTGGTGTACGCGGGCAATGTAAGCTGTAAGAACTTCACTGTGTTGTAGAA