Previous Contig 003009:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS020G03Sequence466003009 (2)gb:AY382676_16040926e-06Lycopersicon esculentum CTR1-like protein kinase (CTR3) mRNA, complete cds.>gb:A
JMFS093E11Sequence583003009 (2)gb:AY382676_16040922e-41Lycopersicon esculentum CTR1-like protein kinase (CTR3) mRNA, complete cds.>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS093E11+ CATCTAATGAAAAATCAGATGTATACAGCTTTGGTGTGATACTGTGGGAGCTGGCAAC
                      ____________________________________________________________
consensus CATCTAATGAAAAATCAGATGTATACAGCTTTGGTGTGATACTGTGGGAGCTGGCAAC
 
. : . : . : . : . : . :
JMFS093E11+ GCTGCAACAACCATGGAGTAATTTGAATCCTGCCCAGGTTGTAGCAGCTGTTGGCTTTAA
                      ____________________________________________________________
consensus GCTGCAACAACCATGGAGTAATTTGAATCCTGCCCAGGTTGTAGCAGCTGTTGGCTTTAA
 
. : . : . : . : . : . :
JMFS093E11+ GTGCAAGAGGCTTGAAATACCACGTGATTTGAATCCTCAAGTGGCAAAAATTATTGAGGC
                      ____________________________________________________________
consensus GTGCAAGAGGCTTGAAATACCACGTGATTTGAATCCTCAAGTGGCAAAAATTATTGAGGC
 
. : . : . : . : . : . :
JMFS093E11+ ATGCTGGGCTAATGAGCCTTGGAAACGTCCTTCATTTTCAAATATAATGGATATGCTGAG
JMFS020G03+ AGCCTTGGAAACGTCCTTCATTTTCAAATATAATGGATATGCTGAG
                      ____________________________________________________________
consensus ATGCTGGGCTAATGAGCCTTGGAAACGTCCTTCATTTTCAAATATAATGGATATGCTGAG
 
. : . : . : . : . : . :
JMFS093E11+ ACCATTGATTAAACCTGCTACTACACCTCAGCAAGTTCGTACAGGCGTGCAATTGCTTAC
JMFS020G03+ ACCATTGATTAAACCTGCTACTACACCTCAGCAAGTTCGTACAGGCGTGCAATTGCTTAC
                      ____________________________________________________________
consensus ACCATTGATTAAACCTGCTACTACACCTCAGCAAGTTCGTACAGGCGTGCAATTGCTTAC
 
. : . : . : . : . : . :
JMFS093E11+ ATGAATGCCTGAAAACTTTTTAAATTGTGTAACGGCACATGGTATTCATTAATTTTCAAG
JMFS020G03+ ATGAATGCCTGAAAACTTTTTAAATTGTGTAACGGCACATGGTATTCATTAATTTTCAAG
                      ____________________________________________________________
consensus ATGAATGCCTGAAAACTTTTTAAATTGTGTAACGGCACATGGTATTCATTAATTTTCAAG
 
. : . : . : . : . : . :
JMFS093E11+ TTGTTGGAGGAAGACTGCTTTGGTTATGTCAGGCTTGTTTGCTTGTGTAAATAATAGTGT
JMFS020G03+ TTGTTGGAGGAAGACTGCTTTGGTTATGTCAGGCTTGTTTGCTTGTGTAAATAATAGTGT
                      ____________________________________________________________
consensus TTGTTGGAGGAAGACTGCTTTGGTTATGTCAGGCTTGTTTGCTTGTGTAAATAATAGTGT
 
. : . : . : . : . : . :
JMFS093E11+ TTTGGACTTCAGATAGCCTGTTGTGAAAACTGATTTTTTACATAGTTCAAGCAGAGCAGC
JMFS020G03+ TTTGGACTTCAGATAGCCTGTTGTGAAAACTGATTTTTTACATAGTTCAAGCAGAGCAGC
                      ____________________________________________________________
consensus TTTGGACTTCAGATAGCCTGTTGTGAAAACTGATTTTTTACATAGTTCAAGCAGAGCAGC
 
. : . : . : . : . : . :
JMFS093E11+ CAACTTCTTTGTGTAATCTGGAAGTGATTCTTTGAATGTTAGCAATCAAATATTTTGTAC
JMFS020G03+ CAACTTCTTTGTGTAATCTGGAAGTGATTCTTTGAATGTTAGCAATCAAATATTTTGTAC
                      ____________________________________________________________
consensus CAACTTCTTTGTGTAATCTGGAAGTGATTCTTTGAATGTTAGCAATCAAATATTTTGTAC
 
. : . : . : . : . : . :
JMFS093E11+ TTTTGTTTGGCAA
JMFS020G03+ TTTTGTTTGGCAATGGTTTTGTATTAGCTATTGTAATTGAGTGTAGTAGGGGGGATACAT
                      ____________________________________________________________
consensus TTTTGTTTGGCAATGGTTTTGTATTAGCTATTGTAATTGAGTGTAGTAGGGGGGATACAT
 
. : . : . : . : . : . :
JMFS020G03+ GCTAGAAAACTAAACCCACATAGTCATTCAAAATGTAGTCAATTCTGGTTTTATGCTGAT
                      ____________________________________________________________
consensus GCTAGAAAACTAAACCCACATAGTCATTCAAAATGTAGTCAATTCTGGTTTTATGCTGAT