Previous Contig 003004:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS020C01Sequence615003004 (2)gb:AP007226_18633146e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF037P21Sequence595003004 (2)gb:AP007226_18633142e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN639023789

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037P21+ TCTGCGTTGAAGGGTCTTCGTTCTCGTGACCATTCTCGTCGCTCTCATCTTCCTCGT
                      ____________________________________________________________
consensus TCTGCGTTGAAGGGTCTTCGTTCTCGTGACCATTCTCGTCGCTCTCATCTTCCTCGT
 
. : . : . : . : . : . :
JMSF037P21+ CCTTCCTTTTCTTGTTGAGCTTCCCGTTCTGGTCTGTGGAACCCGACAATGGAGCCCCCT
                      ____________________________________________________________
consensus CCTTCCTTTTCTTGTTGAGCTTCCCGTTCTGGTCTGTGGAACCCGACAATGGAGCCCCCT
 
. : . : . : . : . : . :
JMSF037P21+ GCCCGCCTTCTCCACCCCCGTGAGGAGATCTGTCTTGATCACCCGACTTGTTTTGGCTCT
                      ____________________________________________________________
consensus GCCCGCCTTCTCCACCCCCGTGAGGAGATCTGTCTTGATCACCCGACTTGTTTTGGCTCT
 
. : . : . : . : . : . :
JMSF037P21+ TGGGCTCGAGCTTCTTTCTTCGGATTACATGCTGCCATATGTTCCTCAGCTCCTCAATCC
                      ____________________________________________________________
consensus TGGGCTCGAGCTTCTTTCTTCGGATTACATGCTGCCATATGTTCCTCAGCTCCTCAATCC
 
. : . : . : . : . : . :
JMSF037P21+ GCACAGGTTTCACGAGATAGTCACAAGCGCCATGAGTTATTCCCTTCATAACAAGTTTGG
                      ____________________________________________________________
consensus GCACAGGTTTCACGAGATAGTCACAAGCGCCATGAGTTATTCCCTTCATAACAAGTTTGG
 
. : . : . : . : . : . :
JMSF037P21+ GATCACTATTCGCCGACAACATGATGACAGGAAGATCCATCTCGAGACCAACGAGCTCGA
JMFS020C01+ ATCACTATTCGCCGACAACATGATGACAGGAAGATCCATCTCGAGACCAACGAGCTCGA
                      ____________________________________________________________
consensus GATCACTATTCGCCGACAACATGATGACAGGAAGATCCATCTCGAGACCAACGAGCTCGA
 
. : . : . : . : . : . :
JMSF037P21+ GCAGCTTAAAACCATCCATATCGGGCATATGAACATCGCTGATCACCAGGTCGAATCTGT
JMFS020C01+ GCAGCTTAAAACCATCCATATCGGGCATATGAACATCGCTGATCACCAGGTCGAATCTGT
                      ____________________________________________________________
consensus GCAGCTTAAAACCATCCATATCGGGCATATGAACATCGCTGATCACCAGGTCGAATCTGT
 
. : . : . : . : . : . :
JMSF037P21+ CTCTGTTATCTCTCAACATCTTCAGTGCCATTCTTGCCTGACTTGATATAGTTAC
JMFS020C01+ CTCTGTTATCTCTCAACATCTTCAGTGCCATTCTTGCCTGACTTGATATAGTTACATGAT
                      ____________________________________________________________
consensus CTCTGTTATCTCTCAACATCTTCAGTGCCATTCTTGCCTGACTTGATATAGTTACATGAT
 
. : . : . : . : . : . :
JMFS020C01+ ACTGGCATTTCCTAAGCAGGCCTTCCAATAACTTCAAGCAAATTGGGTCATCATCAACAG
                      ____________________________________________________________
consensus ACTGGCATTTCCTAAGCAGGCCTTCCAATAACTTCAAGCAAATTGGGTCATCATCAACAG
 
. : . : . : . : . : . :
JMFS020C01+ CAAGAACTCTCATGCCCACTGGGAAGTTGTCATGATTTCCCTTTTCACTCCCCATGTGTC
                      ____________________________________________________________
consensus CAAGAACTCTCATGCCCACTGGGAAGTTGTCATGATTTCCCTTTTCACTCCCCATGTGTC
 
. : . : . : . : . : . :
JMFS020C01+ CTCTTATTTCTTCCACAGTCATCTTTTCCCACCCAAAATTTGTTCTTGAGAAAAGCCCAG
                      ____________________________________________________________
consensus CTCTTATTTCTTCCACAGTCATCTTTTCCCACCCAAAATTTGTTCTTGAGAAAAGCCCAG
 
. : . : . : . : . : . :
JMFS020C01+ ACCAGATCAGAGAATCACTTGCCCAAAGTTCCAATCTTTAGCACAAAAAGGTCAACTTTT
                      ____________________________________________________________
consensus ACCAGATCAGAGAATCACTTGCCCAAAGTTCCAATCTTTAGCACAAAAAGGTCAACTTTT
 
. : . : . : . : . : . :
JMFS020C01+ TTTGGACTATAAACATGTACCCAGAAAGCCTAAAAATGTGAATGAATTCCAGAATTGAGA
                      ____________________________________________________________
consensus TTTGGACTATAAACATGTACCCAGAAAGCCTAAAAATGTGAATGAATTCCAGAATTGAGA
 
. : . : . : . : . : . :
JMFS020C01+ GAAAAGCAGGAGTGAAAGACCAATTAGAAGAAGAGACACAGAAAGTGGAGTCTGTGTTAG
                      ____________________________________________________________
consensus GAAAAGCAGGAGTGAAAGACCAATTAGAAGAAGAGACACAGAAAGTGGAGTCTGTGTTAG
 
. : . : . : . : . : . :
JMFS020C01+ AGAGAGAGAAAGAGAGAGAGTTGTAGTTAGTATAAAGCTGTACGTGTGGACAATGATGGA
                      ____________________________________________________________
consensus AGAGAGAGAAAGAGAGAGAGTTGTAGTTAGTATAAAGCTGTACGTGTGGACAATGATGGA