Previous Contig 003002:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019H06Sequence455003002 (2)gb:BT008655_16398584e-05Arabidopsis thaliana clone RAFL09-89-D06 (R19838) unknown protein (At4g00440) mR
JMFS098A02Sequence144003002 (2)pir|T02457|T024570.002hypothetical protein At2g45900 [imported] - Arabidopsis thaliana>gb:AC004665_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS019H06+ AGTTATGACGGGACATTCCAGATCCTGTACTTCTG
                      ____________________________________________________________
consensus AGTTATGACGGGACATTCCAGATCCTGTACTTCTG
 
. : . : . : . : . : . :
JMFS019H06+ ATATCATCCAAATCAGAGAGAGACAAGTTTCTAGATCTCTTGCAAGTTTTATATGTCTTT
                      ____________________________________________________________
consensus ATATCATCCAAATCAGAGAGAGACAAGTTTCTAGATCTCTTGCAAGTTTTATATGTCTTT
 
. : . : . : . : . : . :
JMFS019H06+ TTAAGGGTCTTTGTTGTATGACTGGCCTGATGTGAGCAATGTAGTTCAGGTTCAATTTCA
                      ____________________________________________________________
consensus TTAAGGGTCTTTGTTGTATGACTGGCCTGATGTGAGCAATGTAGTTCAGGTTCAATTTCA
 
. : . : . : . : . : . :
JMFS019H06+ GTATCATTTCTTGGATTCTTATGACTTGGTTTGCTGGACATATCTTCTTCCATAAGTTCC
                      ____________________________________________________________
consensus GTATCATTTCTTGGATTCTTATGACTTGGTTTGCTGGACATATCTTCTTCCATAAGTTCC
 
. : . : . : . : . : . :
JMFS019H06+ TTGACCCTTGTTTTAACATCAAGGATTACTACCTCTCTTTCTTCATCATCCTCAACTATC
                      ____________________________________________________________
consensus TTGACCCTTGTTTTAACATCAAGGATTACTACCTCTCTTTCTTCATCATCCTCAACTATC
 
. : . : . : . : . : . :
JMFS098A02+ TCCTCATTGGAATCTGGTATAATGAGCTTTGGACTTGAAGCAGTACCAACTTGT
JMFS019H06+ GGACTCTCCTCATTGGAATCTGGTATAATGAGCTTTGGACTTGAAGCAGTACCAACTTGT
                      ____________________________________________________________
consensus GGACTCTCCTCATTGGAATCTGGTATAATGAGCTTTGGACTTGAAGCAGTACCAACTTGT
 
. : . : . : . : . : . :
JMFS098A02+ CTGCTAGCTCGCCTTCTATCTGAAAGCAGCTTTCTGGTAGCTAGACCACGGCGGAAGTCA
JMFS019H06+ CTGCTAGCTCGCCTTCTATCTGAAAGCAGCTTTCTGGTAGCTAGACCACGGCGGAAGTCA
                      ____________________________________________________________
consensus CTGCTAGCTCGCCTTCTATCTGAAAGCAGCTTTCTGGTAGCTAGACCACGGCGGAAGTCA
 
. : . : . : . : . : . :
JMFS098A02+ AATATGCTAATGAAACCCCACATACAACCT
JMFS019H06+ AATATGCTAATGAAACCCCACATACAACCTGCCTGATCCTTCTCANTACGCAAAGAACGC
                      ____________________________________________________________
consensus AATATGCTAATGAAACCCCACATACAACCTGCCTGATCCTTCTCANTACGCAAAGAACGC