Previous Contig 002998:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019C09Sequence571002998 (3)gb:AY531551_16119385e-12Arabidopsis thaliana receptor-like kinase mRNA, complete cds.
JMFS025F02Sequence639002998 (3)gb:AY531551_16119385e-20Arabidopsis thaliana receptor-like kinase mRNA, complete cds.
JMFS028C01Sequence631002998 (3)gb:AY531551_16119386e-20Arabidopsis thaliana receptor-like kinase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS025F02+ TCAGGTTGGCGAAC
JMFS028C01+ AC
                      ____________________________________________________________
consensus TCAGGTTGGCGAAC
 
. : . : . : . : . : . :
JMFS025F02+ CAAAACGGAAGAGTATTAATCTTGAGATCATTGTGGGAAAGATCAAGGCTGGTGAGATTC
JMFS028C01+ CAAAACGGAAGAGTATTAATCTTGAGATCATTGTGGGAAAGATCAAGGCTGGTGAGATTC
                      ____________________________________________________________
consensus CAAAACGGAAGAGTATTAATCTTGAGATCATTGTGGGAAAGATCAAGGCTGGTGAGATTC
 
. : . : . : . : . : . :
JMFS025F02+ TGGAGATTAGAGAGAATCCCCAGATTCTTAAACCTGTTGAAAGAAACATTAATCCTCCGA
JMFS028C01+ TGGAGATTAGAGAGAATCCCCAGATTCTTAAACCTGTTGAAAGAAACATTAATCCTCCGA
JMFS019C09+ TGAAAGAAACATTAATCCTCCGA
                      ____________________________________________________________
consensus TGGAGATTAGAGAGAATCCCCAGATTCTTAAACCTGTTGAAAGAAACATTAATCCTCCGA
 
. : . : . : . : . : . :
JMFS025F02+ ACAGCCGCCGGCGTTTGGTGAACTGCAAACACTGGTTTTAGTTTTAGGACTCCAATGGCG
JMFS028C01+ ACAGCCGCCGGCGTTTGGTGAACTGCAAACACTGGTTTTAGTTTTAGGACTCCAATGGCG
JMFS019C09+ ACAGCCGCCGGCGTTTGGTGAACTGCAAACACTGGTTTTAGTTTTAGGACTCCAATGGCG
                      ____________________________________________________________
consensus ACAGCCGCCGGCGTTTGGTGAACTGCAAACACTGGTTTTAGTTTTAGGACTCCAATGGCG
 
. : . : . : . : . : . :
JMFS025F02+ CCGCCGAGCTTATTCCGGGAGAGATTAATTTCAAGCAGGGTGGAATTAGACCAAACCCAC
JMFS028C01+ CCGCCGAGCTTATTCCGGGAGAGATTAATTTCAAGCAGGGTGGAATTAGACCAAACCCAC
JMFS019C09+ CCGCCGAGCTTATTCCGGGAGAGATTAATTTCAAGCAGGGTGGAATTAGACCAAACCCAC
                      ____________________________________________________________
consensus CCGCCGAGCTTATTCCGGGAGAGATTAATTTCAAGCAGGGTGGAATTAGACCAAACCCAC
 
. : . : . : . : . : . :
JMFS025F02+ GCCGGAACATAGCCCTTCAAGGAATTGTTGGAGAGATCTAAGGTGCGAAGACGAGTCAAA
JMFS028C01+ GCCGGAACATAGCCCTTCAAGGAATTGTTGGAGAGATCTAAGGTGCGAAGACGAGTCAAA
JMFS019C09+ GCCGGAACATAGCCCTTCAAGGAATTGTTGGAGAGATCTAAGGTGCGAAGACGAGTCAAA
                      ____________________________________________________________
consensus GCCGGAACATAGCCCTTCAAGGAATTGTTGGAGAGATCTAAGGTGCGAAGACGAGTCAAA
 
. : . : . : . : . : . :
JMFS025F02+ TTCCTCAAAAACTTCCACGAAATAGCGCCGGTGAGATTTCTCGAAGACATCCTAATCTCA
JMFS028C01+ TTCCTCAAAAACTTCCACGAAATAGCGCCGGTGAGATTTCTCGAAGACATCCTAATCTCA
JMFS019C09+ TTCCTCAAAAACTTCCACGAAATAGCGCCGGTGAGATTTCTCGAAGACATCCTAATCTCA
                      ____________________________________________________________
consensus TTCCTCAAAAACTTCCACGAAATAGCGCCGGTGAGATTTCTCGAAGACATCCTAATCTCA
 
. : . : . : . : . : . :
JMFS025F02+ GAAACCGAGCAGTTTGGGTTTGGCTCCGAGGCTATAAACTCAGAGAGATTAAACCCCACG
JMFS028C01+ GAAACCGAGCAGTTTGGGTTTGGCTCCGAGGCTATAAACTCAGAGAGATTAAACCCCACG
JMFS019C09+ GAAACCGAGCAGTTTGGGTTTGGCTCCGAGGCTATAAACTCAGAGAGATTAAACCCCACG
                      ____________________________________________________________
consensus GAAACCGAGCAGTTTGGGTTTGGCTCCGAGGCTATAAACTCAGAGAGATTAAACCCCACG
 
. : . : . : . : . : . :
JMFS025F02+ ACGGAGCTGAAGGCCTTGGCGACAAGAACATGGTCGGAGGAGTTGCCGCAGGCGGATTCT
JMFS028C01+ ACGGAGCTGAAGGCCTTGGCGACAAGAACATGGTCGGAGGAGTTGCCGCAGGCGGATTCT
JMFS019C09+ ACGGAGCTGAAGGCCTTGGCGACAAGAACATGGTCGGAGGAGTTGCCGCAGGCGGATTCT
                      ____________________________________________________________
consensus ACGGAGCTGAAGGCCTTGGCGACAAGAACATGGTCGGAGGAGTTGCCGCAGGCGGATTCT
 
. : . : . : . : . : . :
JMFS025F02+ GCCGGCGAAAAAACGGAGATTACAAGCACGAAAATGGAGAGAAATTTCATTATCATTGTT
JMFS028C01+ GCCGGCGAAAAAACGGAGATTACAAGCACGAAAATGGAGAGAAATTTCATTATCATTGTT
JMFS019C09+ GCCGGCGAAAAAACGGAGATTACAAGCACGAAAATGGAGAGAAATTTCATTATCATTGTT
                      ____________________________________________________________
consensus GCCGGCGAAAAAACGGAGATTACAAGCACGAAAATGGAGAGAAATTTCATTATCATTGTT
 
. : . : . : . : . : . :
JMFS025F02+ TTGAGTTGATGATTTTGTTCAACTCTTGGAGATTGAAGCTCTTCTTCTTCTCATAAGGGT
JMFS028C01+ TTGAGTTGATGATTTTGTTCAACTCTTGGAGATTGAAGCTCTTCTTCTTCTCATAAGGGT
JMFS019C09+ TTGAGTTGATGATTTTGTTCAACTCTTGGAGATTGAAGCTCTTCTTCTTCTCATAAGGGT
                      ____________________________________________________________
consensus TTGAGTTGATGATTTTGTTCAACTCTTGGAGATTGAAGCTCTTCTTCTTCTCATAAGGGT
 
. : . : . : . : . : . :
JMFS025F02+ GGAA
JMFS028C01+ GGAA
JMFS019C09+ GGAAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGGAAATCTTGGGGG
                      ____________________________________________________________
consensus GGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAATCTTGGGGG