Previous Contig 002997:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019B02Sequence193002997 (2)
JMSF017G12Sequence493002997 (2)gb:AP003803_18335955e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10795010622 (5)gb:BT004254_16373361e-74Arabidopsis thaliana clone RAFL15-07-P19 (R20510) putative amino acid acetyltran

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017G12+ CCAAGCCATGAAGGAGAGAAATATCCTCGAGTATG
                      ____________________________________________________________
consensus CCAAGCCATGAAGGAGAGAAATATCCTCGAGTATG
 
. : . : . : . : . : . :
JMSF017G12+ GAAGACAAGTGTGGACTATCGACGATCTCGGCAGAGAGAACAACGGCAAATGTACTGCCT
                      ____________________________________________________________
consensus GAAGACAAGTGTGGACTATCGACGATCTCGGCAGAGAGAACAACGGCAAATGTACTGCCT
 
. : . : . : . : . : . :
JMSF017G12+ CTGTGCGCCGCGAAGTACGGCTCCGCCTCTCTCATCACCCTCACGAACAGATCATCGCCG
                      ____________________________________________________________
consensus CTGTGCGCCGCGAAGTACGGCTCCGCCTCTCTCATCACCCTCACGAACAGATCATCGCCG
 
. : . : . : . : . : . :
JMSF017G12+ TCGACACCTCTCTTCTCCGGCGACGGCGACGGCGACGAACAACCAACCCCGCCGCCACAG
                      ____________________________________________________________
consensus TCGACACCTCTCTTCTCCGGCGACGGCGACGGCGACGAACAACCAACCCCGCCGCCACAG
 
. : . : . : . : . : . :
JMSF017G12+ CACCTCAGTTTCAACGGAGACCCCGCCGCACCTGTTTTCCTCCAGACCAAAGAGCTCCCC
                      ____________________________________________________________
consensus CACCTCAGTTTCAACGGAGACCCCGCCGCACCTGTTTTCCTCCAGACCAAAGAGCTCCCC
 
. : . : . : . : . : . :
JMSF017G12+ AACCGCGACACCAGGTGGTCTTCTCGCCGCACAGAGAACCAACAGCTTTGTTTCGCCGCA
JMFS019B02+ TTGTTTCGCCGCA
                      ____________________________________________________________
consensus AACCGCGACACCAGGTGGTCTTCTCGCCGCACAGAGAACCAACAGCTTTGTTTCGCCGCA
 
. : . : . : . : . : . :
JMSF017G12+ GCCGCCGCCATACACTGTACTGTCGTCGCAGCACAATAATTCGGTGCGTTGTACGTACGG
JMFS019B02+ GCCGCCGCCATACACTGTACTGTCGTCGCAGCACAATAATTCGGTGCGTTGTACGTACGG
                      ____________________________________________________________
consensus GCCGCCGCCATACACTGTACTGTCGTCGCAGCACAATAATTCGGTGCGTTGTACGTACGG
 
. : . : . : . : . : . :
JMSF017G12+ CGAGAAATTGAGAATGCTCCTCGGAGACGCGGCGATGCGTAGGCGTTTACGTCCTCAGAC
JMFS019B02+ CGAGAAATTGAGAATGCTCCTCGGAGACGCGGCGATGCGTAGGCGTTTACGTCCTCAGAC
                      ____________________________________________________________
consensus CGAGAAATTGAGAATGCTCCTCGGAGACGCGGCGATGCGTAGGCGTTTACGTCCTCAGAC
 
. : . : . : . : . : . :
JMSF017G12+ CCAACCAAACACCGAGAAACACATGTAAATGTAAGCC
JMFS019B02+ CCAACCAAACACCGAGAAACACATGTAAATGTAAGCCAAAGACAAACGGTGAATCTCCAT
                      ____________________________________________________________
consensus CCAACCAAACACCGAGAAACACATGTAAATGTAAGCCAAAGACAAACGGTGAATCTCCAT