Previous Contig 002992:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS018G08Sequence618002992 (3)
JMSF005E08Sequence262002992 (3)
JMSF023J13Sequence268002992 (3)204013845 (3)gb:AB017065_15133792e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFC16.>gb:BT014856_1641

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS018G08+ CCATCACTATCTTCTTTT
                      ____________________________________________________________
consensus CCATCACTATCTTCTTTT
 
. : . : . : . : . : . :
JMFS018G08+ GCAACATTGCCTTGAGCCCAAACNCCACCCATAAAAATACCCATACACAGTGCTACTATA
                      ____________________________________________________________
consensus GCAACATTGCCTTGAGCCCAAACNCCACCCATAAAAATACCCATACACAGTGCTACTATA
 
. : . : . : . : . : . :
JMFS018G08+ ATTATTATTACAAGATCAAACTTAATAATGCCAAAAACCCTCCCCATTTTCTGCATACCA
                      ____________________________________________________________
consensus ATTATTATTACAAGATCAAACTTAATAATGCCAAAAACCCTCCCCATTTTCTGCATACCA
 
. : . : . : . : . : . :
JMFS018G08+ AGAATTCCCAGCAAATCTGGATTCTAGACAAATGAATAAAATAATAGAGTACCCTTTCTG
                      ____________________________________________________________
consensus AGAATTCCCAGCAAATCTGGATTCTAGACAAATGAATAAAATAATAGAGTACCCTTTCTG
 
. : . : . : . : . : . :
JMSF023J13+ AAAAAAAAAAAAAATGGAATTTTT
JMSF005E08+ AAAAAAAAAAAAATGGAATTTTT
JMFS018G08+ ATCTTCAATAACAATAAGTGCCCATTTGCAGAACCCAAAAAAAAAAAAAATGGAATTTTT
                      ____________________________________________________________
consensus ATCTTCAATAACAATAAGTGCCCATTTGCAGAACCCAAAAAAAAAAAAAATGGAATTTTT
 
. : . : . : . : . : . :
JMSF023J13+ TTCAAGAAATAAAGGTACCAGTTTGCAGAATCAGAAGATTCAACCAAAAAGAAATAAAAT
JMSF005E08+ TTCAAGAAATAAAGGTACCAGTTTGCAGAATCAGAAGATTCNACCAAAAAGAAATAAAAT
JMFS018G08+ TTCAAGAAATAAAGGTACCAGTTTGCAGAATCAGAAGATTCAACCAAAAAGAAATAAAAT
                      ____________________________________________________________
consensus TTCAAGAAATAAAGGTACCAGTTTGCAGAATCAGAAGATTCAACCAAAAAGAAATAAAAT
 
. : . : . : . : . : . :
JMSF023J13+ GAGCTCTCTCTCTCTGGGGTTTTTCAAGAACTACCCATTCGCAGAAGCGGCAAAATGCAG
JMSF005E08+ GAGCTCTCTCTCTCTGGGGTTTTTCAAGAACTACCCATTCGCAGAAGCGGCAAAATGCNG
JMFS018G08+ GAGCTCTCTCTCTCTGGGGTTTTTCAAGAACTACCCATTCGCAGAAGCGGCAAAATGCAG
                      ____________________________________________________________
consensus GAGCTCTCTCTCTCTGGGGTTTTTCAAGAACTACCCATTCGCAGAAGCGGCAAAATGCAG
 
. : . : . : . : . : . :
JMSF023J13+ TATAATATTAACCCAGAAAGCAAAGCAAAGAGAAGAGAAGAGAAGAGCCTTTTGCACTAC
JMSF005E08+ TATAATATTAACCCAGAAAGCAAAGCAAAGAGAAGAGAAGAGAAGAGCCTTTTGCACTAC
JMFS018G08+ TATAATATTAACCCAGAAAGCAAAGCAAAGAGAAGAGAAGAGAAGAGCCTTTTGCACTAC
                      ____________________________________________________________
consensus TATAATATTAACCCAGAAAGCAAAGCAAAGAGAAGAGAAGAGAAGAGCCTTTTGCACTAC
 
. : . : . : . : . : . :
JMSF023J13+ AACTGTAAAGCCAAAGCTCCCAAACAAACTAGCAAGCAC
JMSF005E08+ AACTGTAAAGCCAAAGCTCCCAAACAAACTAGCAAGCAC
JMFS018G08+ AACTGTAAAGCCAAAGCTCCCAAACAAACTAGCAAGCACACCATTAACTCTGGTCTGTGG
                      ____________________________________________________________
consensus AACTGTAAAGCCAAAGCTCCCAAACAAACTAGCAAGCACACCATTAACTCTGGTCTGTGG
 
. : . : . : . : . : . :
JMFS018G08+ GAGGGCACTAAAAATAAAGCAGAAGATAAAGAAAAGGAGAATCCGTGAAATGGCCCAACT
                      ____________________________________________________________
consensus GAGGGCACTAAAAATAAAGCAGAAGATAAAGAAAAGGAGAATCCGTGAAATGGCCCAACT
 
. : . : . : . : . : . :
JMFS018G08+ TTTTTCTTGGGTGCTGCGCATATGAAGAAGAAGAAGCGTTAATTATCTAATGCGAGCAAG
                      ____________________________________________________________
consensus TTTTTCTTGGGTGCTGCGCATATGAAGAAGAAGAAGCGTTAATTATCTAATGCGAGCAAG