Previous Contig 002990:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS018G06Sequence627002990 (2)gb:AE016959_10234322e-27Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMFS164A02Sequence599002990 (2)gb:AE016959_10234328e-21Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS164A02+ CTTTGATAGTGCTT
                      ____________________________________________________________
consensus CTTTGATAGTGCTT
 
. : . : . : . : . : . :
JMFS164A02+ CGGCCATGTTATGAATATTGGTGNCTAAGTCCTGGTCATTGCTCCATATTTGAGAAATAA
                      ____________________________________________________________
consensus CGGCCATGTTATGAATATTGGTGNCTAAGTCCTGGTCATTGCTCCATATTTGAGAAATAA
 
. : . : . : . : . : . :
JMFS164A02+ GGCTGGAATAATCCTTGTGTGTAGTCCATGCAGTGTTGAATCTGAAAGTTTTATTCCTGA
                      ____________________________________________________________
consensus GGCTGGAATAATCCTTGTGTGTAGTCCATGCAGTGTTGAATCTGAAAGTTTTATTCCTGA
 
. : . : . : . : . : . :
JMFS164A02+ CTACTTGTATTATCTCATTTGTGTTAATGAGTAAGGGAGAGTGGTCCGACCCAATTATTG
JMFS018G06+ AGGGAGAGTGGTCCGACCCAATATTTG
                      ____________________________________________________________
consensus CTACTTGTATTATCTCATTTGTGTTAATGAGTAAGGGAGAGTGGTCCGACCCAATTTTTG
 
. : . : . : . : . : . :
JMFS164A02+ GGAGGTGTTTAACGACCGCATTCGGAAACTCCATTTTCCATTCTATGTTGCTCAAAGCCC
JMFS018G06+ GNAGGTGTTTAACGACCGCATTCGGAAACTCCATTTTCCATTCTATGTTGCTCAAAGCCC
                      ____________________________________________________________
consensus GGAGGTGTTTAACGACCGCATTCGGAAACTCCATTTTCCATTCTATGTTGCTCAAAGCCC
 
. : . : . : . : . : . :
JMFS164A02+ GATCAAGTCGTGCTGCCTTGAATGTATCTGATTCGGCTCCTCTCATCCATGTATACTGGG
JMFS018G06+ GATCAAGTCGTGCTGCCTTGAATGTATCTGATTCGGCTCCTCTCATCCATGTATACTGGG
                      ____________________________________________________________
consensus GATCAAGTCGTGCTGCCTTGAATGTATCTGATTCGGCTCCTCTCATCCATGTATACTGGG
 
. : . : . : . : . : . :
JMFS164A02+ GACCTGAGAATCCTAAATCAATAAGCCCCTCTTGGAAGATCCATTTGTTGAAATCTGAAC
JMFS018G06+ GACCTGAGAATCCTAAATCAATAAGCCCCTCTTGGAAGATCCATTTGTTGAAATCTGAAC
                      ____________________________________________________________
consensus GACCTGAGAATCCTAAATCAATAAGCCCCTCTTGGAAGATCCATTTGTTGAAATCTGAAC
 
. : . : . : . : . : . :
JMFS164A02+ ATCTTGTTTGTGAAAAGCTATCAGGATTACTGGCTTCCTCGCGACAGGTCACAGAATTAA
JMFS018G06+ ATCTTGTTTGTGAAAAGCTATCAGGATTACTGGCTTCCTCGCGACAGGTCACAGAATTAA
                      ____________________________________________________________
consensus ATCTTGTTTGTGAAAAGCTATCAGGATTACTGGCTTCCTCGCGACAGGTCACAGAATTAA
 
. : . : . : . : . : . :
JMFS164A02+ AGTCTCCTGCATTAAGCCAAGGGCCTCTAAGATCAAGAGCTTCACTTGTGAGATCCGAGA
JMFS018G06+ AGTCTCCTGCATTAAGCCAAGGGCCTCTAAGATCAAGAGCTTCACTTGTGAGATCCGAGA
                      ____________________________________________________________
consensus AGTCTCCTGCATTAAGCCAAGGGCCTCTAAGATCAAGAGCTTCACTTGTGAGATCCGAGA
 
. : . : . : . : . : . :
JMFS164A02+ AGAGTTTTCTACGCAGGGCGTGGTTTGGACTGCCGTAGACCACCGCGAATATCCATGGTT
JMFS018G06+ AGAGTTTTCTACGCAGGGCGTGGTTTGGACTGCCGTAGACCACCGCGAATATCCATGGTT
                      ____________________________________________________________
consensus AGAGTTTTCTACGCAGGGCGTGGTTTGGACTGCCGTAGACCACCGCGAATATCCATGGTT
 
. : . : . : . : . : . :
JMFS164A02+ GGACGTGTACTTCTTTAACCTGCAAAAGAGCGAACTGTGGGTGAG
JMFS018G06+ GGACGTGTACTTCTTTAACCTGCAAAAGAGCGAACTGTGGGTGAGTATGCATCATCTCGA
                      ____________________________________________________________
consensus GGACGTGTACTTCTTTAACCTGCAAAAGAGCGAACTGTGGGTGAGTATGCATCATCTCGA
 
. : . : . : . : . : . :
JMFS018G06+ TTGAGATGGAGTTCTTCCATAATACCCAAATTCCTCCTGAGAATCCTACGGCTTCTATAC
                      ____________________________________________________________
consensus TTGAGATGGAGTTCTTCCATAATACCCAAATTCCTCCTGAGAATCCTACGGCTTCTATAC
 
. : . : . : . : . : . :
JMFS018G06+ GAAACCACTCGTCGAAACCTAATCTAAAGCAGATTTTATTGGCATGAGATCCAGAAACTT
                      ____________________________________________________________
consensus GAAACCACTCGTCGAAACCTAATCTAAAGCAGATTTTATTGGCATGAGATCCAGAAACTT
 
. : . : . : . : . : . :
JMFS018G06+ TAGTCTCAAGTAGGCATATCAAAACAGGATTATACTCCCGGATCATTTGTTTTAGAGTGC
                      ____________________________________________________________
consensus TAGTCTCAAGTAGGCATATCAAAACAGGATTATACTCCCGGATCATTTGTTTTAGAGTGC