Previous Contig 002987:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS018F07Sequence617002987 (3)pir|S05453|S054531e-05transcription factor TGA1b, TGACG-binding - common tobacco (fragment)
JMFS076E06Sequence621002987 (3)pir|S05453|S054534e-06transcription factor TGA1b, TGACG-binding - common tobacco (fragment)
JMFS133B12Sequence619002987 (3)pir|S05453|S054534e-06transcription factor TGA1b, TGACG-binding - common tobacco (fragment)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS133B12+ AAGCCTCGCGATTAGACCCATTCGAC
JMFS076E06+ AAGCCTCGCGATTAGACCCATTCGAC
JMFS018F07+ GATTAGACCCATTCGAC
                      ____________________________________________________________
consensus AAGCCTCGCGATTAGACCCATTCGAC
 
. : . : . : . : . : . :
JMFS133B12+ TCAGGCGATGGAACATTCAGGTATCCAGAGACATCTCCGTAAATCTGCTGAGATTCCGGC
JMFS076E06+ TCAGGCGATGGAACATTCAGGTATCCAGAGACATCTCCGTAAATCTGCTGAGATTCCGGC
JMFS018F07+ TCAGGCGATGGAACATTCAGGTATCCAGAGACATCTCCGTAAATCTGCTGAGATTCCGGC
                      ____________________________________________________________
consensus TCAGGCGATGGAACATTCAGGTATCCAGAGACATCTCCGTAAATCTGCTGAGATTCCGGC
 
. : . : . : . : . : . :
JMFS133B12+ GAGTTCACGACCAAAACCCTAGAAGAGCTCGAGCTTAGCTCCGGCGAAACAGAATTCAGA
JMFS076E06+ GAGTTCACGACCAAAACCCTAGAAGAGCTCGAGCTTAGCTCCGGCGAAACAGAATTCAGA
JMFS018F07+ GAGTTCACGACCAAAACCCTAGAAGAGCTCGAGCTTAGCTCCGGCGAAACAGAATTCAGA
                      ____________________________________________________________
consensus GAGTTCACGACCAAAACCCTAGAAGAGCTCGAGCTTAGCTCCGGCGAAACAGAATTCAGA
 
. : . : . : . : . : . :
JMFS133B12+ AGCATGGCGTCTCCGGCAATCTGATCGGCGGAGAAATGACACAGTTCTGAAGACGACGAC
JMFS076E06+ AGCATGGCGTCTCCGGCAATCTGATCGGCGGAGAAATGACACAGTTCTGAAGACGACGAC
JMFS018F07+ AGCATGGCGTCTCCGGCAATCTGATCGGCGGAGAAATGACACAGTTCTGAAGACGACGAC
                      ____________________________________________________________
consensus AGCATGGCGTCTCCGGCAATCTGATCGGCGGAGAAATGACACAGTTCTGAAGACGACGAC
 
. : . : . : . : . : . :
JMFS133B12+ TTGAAAATGCTAGCAGAATTCTTAAACGCCCCGATCGGTTCACAGCCAGACCCGGGTTGC
JMFS076E06+ TTGAAAATGCTAGCAGAATTCTTAAACGCCCCGATCGGTTCACAGCCAGACCCGGGTTGC
JMFS018F07+ TTGAAAATGCTAGCAGAATTCTTAAACGCCCCGATCGGTTCACAGCCAGACCCGGGTTGC
                      ____________________________________________________________
consensus TTGAAAATGCTAGCAGAATTCTTAAACGCCCCGATCGGTTCACAGCCAGACCCGGGTTGC
 
. : . : . : . : . : . :
JMFS133B12+ ACGTAACAAGTGGGACCTACATCAAGCTGCGCCTGCACCGGATCACAACCGGCCTGGTCG
JMFS076E06+ ACGTAACAAGTGGGACCTACATCAAGCTGCGCCTGCACCGGATCACAACCGGCCTGGTCG
JMFS018F07+ ACGTAACAAGTGGGACCTACATCAAGCTGCGCCTGCACCGGATCACAACCGGCCTGGTCG
                      ____________________________________________________________
consensus ACGTAACAAGTGGGACCTACATCAAGCTGCGCCTGCACCGGATCACAACCGGCCTGGTCG
 
. : . : . : . : . : . :
JMFS133B12+ AGCGAAACTGGTAGGAAATTTTGACTGAGAGAATTATCCGCACCGAAGGGAAGGCAGAAA
JMFS076E06+ AGCGAAACTGGTAGGAAATTTTGACTGAGAGAATTATCCGCACCGAAGGGAAGGCAGAAA
JMFS018F07+ AGCGAAACTGGTAGGAAATTTTGACTGAGAGAATTATCCGCAACGAAGGGAAGGCAGAAA
                      ____________________________________________________________
consensus AGCGAAACTGGTAGGAAATTTTGACTGAGAGAATTATCCGCACCGAAGGGAAGGCAGAAA
 
. : . : . : . : . : . :
JMFS133B12+ TCATCGAAGGAGAAGTCGAAGGGGAAGTCGAAGTCGTCCATCACCACGTCGTCGTTTTGG
JMFS076E06+ TCATCGAAGGAGAAGTCGAAGGGGAAGTCGAAGTCGTCCATCACCACGTCGTCGTTTTGG
JMFS018F07+ TCATCGAAGGAAAAGTCGAAGGGGAAGTCGAAGTCGTCCATCACCACGTCGTCGTTTTGG
                      ____________________________________________________________
consensus TCATCGAAGGAGAAGTCGAAGGGGAAGTCGAAGTCGTCCATCACCACGTCGTCGTTTTGG
 
. : . : . : . : . : . :
JMFS133B12+ AACATGTGTGCGGCTTCCAGAGGTGAAATTGGGAGGACGTCCTCCAATCCATCGGCAGCG
JMFS076E06+ AACATGTGTGCGGCTTCCAGAGGTGAAATTGGGAGGACGTCCTCCAATCCATCGGCAGCG
JMFS018F07+ AACATGTGTGCGGCTTCCAGAGGTGAAATTGGGAGGACGTCCTCCAATCCATCGGCAGCG
                      ____________________________________________________________
consensus AACATGTGTGCGGCTTCCAGAGGTGAAATTGGGAGGACGTCCTCCAATCCATCGGCAGCG
 
. : . : . : . : . : . :
JMFS133B12+ CCAGTGGCGGTGGTGAGGTTGAGATTTGATGGCGGCGTCGGTGGCTCCGCCACCGCTGTT
JMFS076E06+ CCAGTGGCGGTGGTGAGGTTGAGATTTGATGGCGGCGTCGGTGGCTCCGCCACCGCTGTT
JMFS018F07+ CCAGTGGCGGTGGTGAGGTTGAGATTTGATGGCGGCGTCGGTGGCTCCGCCACCGCTGTT
                      ____________________________________________________________
consensus CCAGTGGCGGTGGTGAGGTTGAGATTTGATGGCGGCGTCGGTGGCTCCGCCACCGCTGTT
 
. : . : . : . : . : . :
JMFS133B12+ TTGGCCATGGTTTGTAGGTTTCCGACAATGGATCACAGAGAGAGAGAGAGAGA
JMFS076E06+ TTGGCCATGGTTTGTAGGTTTCCGACAATGGATCACAGAGAGAGAGAGAGAGA
JMFS018F07+ TTGGCCATGGTTTGTAGGTTTCCGACAATGGATCACAGAGAGAGAGAGAGAGAGATATTG
                      ____________________________________________________________
consensus TTGGCCATGGTTTGTAGGTTTCCGACAATGGATCACAGAGAGAGAGAGAGAGAGATATTG