Previous Contig 002979:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS017F04Sequence627002979 (3)gb:BT015791_16424092e-31Arabidopsis thaliana At5g39660 mRNA, complete cds.
JMFS054F06Sequence629002979 (3)gb:BT015791_16424099e-34Arabidopsis thaliana At5g39660 mRNA, complete cds.
JMFS064F05Sequence633002979 (3)gb:BT015791_16424091e-36Arabidopsis thaliana At5g39660 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS064F05+ AGCA
                      ____________________________________________________________
consensus AGCA
 
. : . : . : . : . : . :
JMFS064F05+ GCCGAGTTCTTGGTTTTTCTTCGGCCAGCACCAACAGGCAAGTTCCTCGTCATCCCACCC
JMFS054F06+ CGGCCAGCACCAACAGGCAAGTTCCTCGTCATCCCACCC
JMFS017F04+ ACAGGCAAGTTCCTCGTCATCCCACCC
                      ____________________________________________________________
consensus GCCGAGTTCTTGGTTTTTCTTCGGCCAGCACCAACAGGCAAGTTCCTCGTCATCCCACCC
 
. : . : . : . : . : . :
JMFS064F05+ GACGTCCAATATCTCTGGCATTTCTTGCAGAAATGGCGAGGCTGGTTCGTGTTGTAGTTG
JMFS054F06+ GACGTCCAATATCTCTGGCATTTCTTGCAGAAATGGCGAGGCTGGTTCGTGTTGTAGTTG
JMFS017F04+ GACGTCCAATATCTCTGGCATTTCTTGCAGAAATGGCGAGGCTGGTTCGTGTTGTAGTTG
                      ____________________________________________________________
consensus GACGTCCAATATCTCTGGCATTTCTTGCAGAAATGGCGAGGCTGGTTCGTGTTGTAGTTG
 
. : . : . : . : . : . :
JMFS064F05+ TTGAAATAACAGAACTTGGTGTCCATACTGTCACATCTAGGACATGGAAGTATCTTGTCT
JMFS054F06+ TTGAAATAACAGAACTTGGTGTCCATACTGTCACATCTAGGACATGGAAGTATCTTGTCT
JMFS017F04+ TTGAAATAACAGAACTTGGTGTCCATACTGTCACATCTAGGACATGGAAGTATCTTGTCT
                      ____________________________________________________________
consensus TTGAAATAACAGAACTTGGTGTCCATACTGTCACATCTAGGACATGGAAGTATCTTGTCT
 
. : . : . : . : . : . :
JMFS064F05+ GGTTTTTTCAGAGTCTTATCTTTCCCATTACTCATTTTCCCCTCTTCTTCATCAGTTGTT
JMFS054F06+ GGTTTTTTCAGAGTCTTATCTTTCCCATTACTCATTTTCCCCTCTTCTTCATCAGTTGTT
JMFS017F04+ GGTTTTTTCAGAGTCTTATCTTTCCCATTACTCATTTTCCCCTCTTCTTCATCAGTTGTT
                      ____________________________________________________________
consensus GGTTTTTTCAGAGTCTTATCTTTCCCATTACTCATTTTCCCCTCTTCTTCATCAGTTGTT
 
. : . : . : . : . : . :
JMFS064F05+ GAAATTTCAGTTGATCCACAATCTTCATCAACATGTGGTGCTTTTAAGCCATCCCTAATT
JMFS054F06+ GAAATTTCAGTTGATCCACAATCTTCATCAACATGTGGTGCTTTTAAGCCATCCCTAATT
JMFS017F04+ GAAATTTCAGTTGATCCACAATCTTCATCAACATGTGGTGCTTTTAAGCCATCCCTAATT
                      ____________________________________________________________
consensus GAAATTTCAGTTGATCCACAATCTTCATCAACATGTGGTGCTTTTAAGCCATCCCTAATT
 
. : . : . : . : . : . :
JMFS064F05+ TCATCTACAGTCTGATCCATTATCCCTTCCCCTTCCATTAACACTGTTCCTTCATCCTCT
JMFS054F06+ TCATCTACAGTCTGATCCATTATCCCTTCCCCTTCCATTAACACTGTTCCTTCATCCTCT
JMFS017F04+ TCATCTACAGTCTGATCCATTATCCCTTCCCCTTCCATTAACACTGTTCCTTCATCCTCT
                      ____________________________________________________________
consensus TCATCTACAGTCTGATCCATTATCCCTTCCCCTTCCATTAACACTGTTCCTTCATCCTCT
 
. : . : . : . : . : . :
JMFS064F05+ TTACTTTCATCCATCCTCTCTCCATTTTCATTCTTTTGCTGTTGTTCATCCTCTCCGGGC
JMFS054F06+ TTACTTTCATCCATCCTCTCTCCATTTTCATTCTTTTGCTGTTGTTCATCCTCTCCGGGC
JMFS017F04+ TTACTTTCATCCATCCTCTCTCCATTTTCATTCTTTTGCTGTTGTTCATCCTCTCCGGGC
                      ____________________________________________________________
consensus TTACTTTCATCCATCCTCTCTCCATTTTCATTCTTTTGCTGTTGTTCATCCTCTCCGGGC
 
. : . : . : . : . : . :
JMFS064F05+ TCAGCTTCTGAACAAGAACTATCTTTAGCCAAGGAATTGGCTTCTGAAGCTGCTCCGCCG
JMFS054F06+ TCAGCTTCTGAACAAGAACTATCTTTAGCCAAGGAATTGGCTTCTGAAGCTGCTCCGCCG
JMFS017F04+ TCAGCTTCTGAACAAGAACTATCTTTAGCCAAGGAATTGGCTTCTGAAGCTGCTCCGCCG
                      ____________________________________________________________
consensus TCAGCTTCTGAACAAGAACTATCTTTAGCCAAGGAATTGGCTTCTGAAGCTGCTCCGCCG
 
. : . : . : . : . : . :
JMFS064F05+ GGGTCGACATCCATCTCCGTCGGCGGCGGCGGCGGCGGAGCATCCGGGAACTGGATAGTC
JMFS054F06+ GGGTCGACATCCATCTCCGTCGGCGGCGGCGGCGGCGGAGCATCCGGGAACTGGATAGTC
JMFS017F04+ GGGTCGACATCCATCTCCGTCGGCGGCGGCGGCGGCGGAGCATCCGGGAACTGGATAGTC
                      ____________________________________________________________
consensus GGGTCGACATCCATCTCCGTCGGCGGCGGCGGCGGCGGAGCATCCGGGAACTGGATAGTC
 
. : . : . : . : . : . :
JMFS064F05+ ATCCCGAACAGCTTTATCGTCGGGTCCTTGGTCGGTTCCGGCATTACAGTTGCTGAAAAC
JMFS054F06+ ATCCCGAACAGCTTTATCGTCGGGTCCTTGGTCGGTTCCGGCATTACAGTTGCTGAAAAC
JMFS017F04+ ATCCCGAACAGCTTTATCGTCGGGTCCTTGGTCGGTTCCGGCATTACAGTTGCTGAAAAC
                      ____________________________________________________________
consensus ATCCCGAACAGCTTTATCGTCGGGTCCTTGGTCGGTTCCGGCATTACAGTTGCTGAAAAC
 
. : . : . : . : . : . :
JMFS064F05+ TGAGAAATCAGAATCACAGCAAAAGGGCG
JMFS054F06+ TGAGAAATCAGAATCACAGCAAAAGGGCGAAAAAGCAAAGAGTATAATAA
JMFS017F04+ TGAGAAATCAGAATCACAGCAAAAGGGCGAAAAAGCAAAGAGTATAATAATCCGATGATT
                      ____________________________________________________________
consensus TGAGAAATCAGAATCACAGCAAAAGGGCGAAAAAGCAAAGAGTATAATAATCCGATGATT