Previous Contig 002977:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018A05Sequence583002977 (4)gb:BT015329_16421575e-58Arabidopsis thaliana At3g24420 gene, complete cds.>gb:BT015839_1642457 Arabidops
JMFN029A06Sequence553002977 (4)gb:BT015329_16421572e-21Arabidopsis thaliana At3g24420 gene, complete cds.>gb:BT015839_1642457 Arabidops
JMFS017E06Sequence610002977 (4)gb:BT015329_16421577e-57Arabidopsis thaliana At3g24420 gene, complete cds.>gb:BT015839_1642457 Arabidops
JMFS030A05Sequence609002977 (4)gb:BT015329_16421576e-57Arabidopsis thaliana At3g24420 gene, complete cds.>gb:BT015839_1642457 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN029A06+ CACAAATACATACCACTTCACTTCATG
                      ____________________________________________________________
consensus CACAAATACATACCACTTCACTTCATG
 
. : . : . : . : . : . :
JMFN029A06+ TCCACTACCCAAAATAGAGATCAGATCAGAAAGAGAGAGAGAGAGATAATAATTAATAAC
                      ____________________________________________________________
consensus TCCACTACCCAAAATAGAGATCAGATCAGAAAGAGAGAGAGAGAGATAATAATTAATAAC
 
. : . : . : . : . : . :
JMFN029A06+ AACAAACAAAACTATATATATCGATCGTTTGATTTTTTTGTCTTGTCACACAAATTTCAT
                      ____________________________________________________________
consensus AACAAACAAAACTATATATATCGATCGTTTGATTTTTTTGTCTTGTCACACAAATTTCAT
 
. : . : . : . : . : . :
JMFN029A06+ TCGATCTTTTCAACCCAAGGCTGCGAAAACAACCTCAAGAAATTCTTCATGCGCCGTGAG
                      ____________________________________________________________
consensus TCGATCTTTTCAACCCAAGGCTGCGAAAACAACCTCAAGAAATTCTTCATGCGCCGTGAG
 
. : . : . : . : . : . :
JMFN029A06+ CTGCGGGAAATGCCCTTCGGTGTTCACAATCTCCACCGCCGATTCGCCCTTGATCCGGCT
                      ____________________________________________________________
consensus CTGCGGGAAATGCCCTTCGGTGTTCACAATCTCCACCGCCGATTCGCCCTTGATCCGGCT
 
. : . : . : . : . : . :
JMFN029A06+ GTGCATGAAGGTGACGACCGACGGCGGAACGACGAGGTCGCGTTTCGTGTGGACTAAGGT
                      ____________________________________________________________
consensus GTGCATGAAGGTGACGACCGACGGCGGAACGACGAGGTCGCGTTTCGTGTGGACTAAGGT
 
. : . : . : . : . : . :
JMFN029A06+ GACCGGAGCGACAACCTTGTCGAGAACGCTCCGGTGGTCGCTCAAGAACACGGTTTTGGC
JMFN018A05+ TGTCGAGAACGCTNCGGTGGTCGCTCAAGAACACGGTTTTGGC
JMFS030A05+ TTTGGC
JMFS017E06+ TTTGGC
                      ____________________________________________________________
consensus GACCGGAGCGACAACCTTGTCGAGAACGCTCCGGTGGTCGCTCAAGAACACGGTTTTGGC
 
. : . : . : . : . : . :
JMFN029A06+ CAACGGCAGCCCGATCTCCACCCCCATTCTCTTCAGGCATTTCGCTAACTTCTCCACCGA
JMFN018A05+ CAACGGCAGCCCGATCTCCACCNCCATTCTCTTCAGGCATTTCGCTAACTTCTCCACCGA
JMFS030A05+ CAACGGCAGCCCGATCTCCACCCCCATTCTCTTCAGGCATTTCGCTAACTTCTCCACCGA
JMFS017E06+ CAACGGCAGCCCGATCTCCACCCCCATTCTCTTCAGGCATTTCGCTAACTTCTCCACCGA
                      ____________________________________________________________
consensus CAACGGCAGCCCGATCTCCACCCCCATTCTCTTCAGGCATTTCGCTAACTTCTCCACCGA
 
. : . : . : . : . : . :
JMFN029A06+ CGGAGGGTCCGACGGGTCCACCACCATCGCCGCAAACGCCGAGCACCATTGCTCGTAGTT
JMFN018A05+ CGGAGGGTCCGACGGGTCCACCACCATCGCCGCAAACGCCGAGCACCATTGCTCGTAGTT
JMFS030A05+ CGAAGGGTCCGACGGGTCCACCACCATCGCCGCAAACGCCGAGCACCATTGCTCGTAGTT
JMFS017E06+ CGGAGGGTCCGACGGGTCCACCACCATCGCCGCAAACGCCGAGCACCATTGCTCGTAGTT
                      ____________________________________________________________
consensus CGGAGGGTCCGACGGGTCCACCACCATCGCCGCAAACGCCGAGCACCATTGCTCGTAGTT
 
. : . : . : . : . : . :
JMFN029A06+ TGTTTCCATGTCGGCGAACATTTCATCAACGTAGGATATATCGAAA
JMFN018A05+ TGTTTCCATGTCGGCGAACATTTCATCAACGTAGGATATATCGAAACCCCCTTCGTAGTC
JMFS030A05+ TGTTTCCATGTCGGCGAACATTTCATCAACGTAGGATATATCGAAACCCCCTTCGTAGTC
JMFS017E06+ TGTTTCCATGTCGGCGAACATTTCATCAACGTAGGATATATCGAAACCCCCTTCGTAGTC
                      ____________________________________________________________
consensus TGTTTCCATGTCGGCGAACATTTCATCAACGTAGGATATATCGAAACCCCCTTCGTAGTC
 
. : . : . : . : . : . :
JMFN018A05+ TTCAAGGTTTATGAATCTGGGAGAGGAGGCAACAAGGATGAGTTTAGTGAAAAGGTCAGG
JMFS030A05+ TTCAAGGTTTATGAATCTGGGAGAGGAGGCAACAAGGATGAGTTTAGTGAAAAGGTCAGG
JMFS017E06+ TTCAAGGTTTATGAATCTGGGAGAGGAGGCAACAAGGATGAGTTTAGTGAAAAGGTCAGG
                      ____________________________________________________________
consensus TTCAAGGTTTATGAATCTGGGAGAGGAGGCAACAAGGATGAGTTTAGTGAAAAGGTCAGG
 
. : . : . : . : . : . :
JMFN018A05+ TCTTTTAACAGAAGCTATGCAGCCAATCATGCCAGACATGGAGTGGCCAATGAACACACA
JMFS030A05+ TCTTTTAACAGAAGCTATGCAGCCAATCATGCCAGACATGGAGTGGCCAATGAACACACA
JMFS017E06+ TCTTTTAACAGAAGCTATGCAGCCAATCATGCCAGACATGGAGTGGCCAATGAACACACA
                      ____________________________________________________________
consensus TCTTTTAACAGAAGCTATGCAGCCAATCATGCCAGACATGGAGTGGCCAATGAACACACA
 
. : . : . : . : . : . :
JMFN018A05+ GGATTTCAAGTTCAGCTCTTCAAGAAGCCCAATCAAGTCATCAGCAAAAGCTTCATAGCA
JMFS030A05+ GGATTTCAAGTTCAGCTCTTCAAGAAGCCCAATCAAGTCATCAGCAAAAGCTTCATAGCA
JMFS017E06+ GGATTTCAAGTTCAGCTCTTCAAGAAGCCCAATCAAGTCATCAGCAAAAGCTTCATAGCA
                      ____________________________________________________________
consensus GGATTTCAAGTTCAGCTCTTCAAGAAGCCCAATCAAGTCATCAGCAAAAGCTTCATAGCA
 
. : . : . : . : . : . :
JMFN018A05+ AGAGTACTTCACACCATCAAAGAGACTCCTGTCTTTTATGGCACCAGAAAAGCACCAATC
JMFS030A05+ AGAGTACTTCACACCATCAAAGAGACTCCTGTCTTTTATGGCACCAGAAAAGCACCAATC
JMFS017E06+ AGAGTACTTCACACCATCAAAGAGACTCCTGTCTTTTATGGCACCAGAAAAGCACCAATC
                      ____________________________________________________________
consensus AGAGTACTTCACACCATCAAAGAGACTCCTGTCTTTTATGGCACCAGAAAAGCACCAATC
 
. : . : . : . : . : . :
JMFN018A05+ AAACAGGAGAAGTTGGTATCTCTCCCCCAGTTTTGGCACAACTTTCTCCCACACAGACTG
JMFS030A05+ AAACAGGAGAAGTTGGTATCTCTCCCCCAGTTTTGGCACAACTTTCTCCCACACAGACTG
JMFS017E06+ AAACAGGAGAAGTTGGTATCTCTCCCCCAGTTTTGGCACAACTTTCTCCCACACAGACTG
                      ____________________________________________________________
consensus AAACAGGAGAAGTTGGTATCTCTCCCCCAGTTTTGGCACAACTTTCTCCCACACAGACTG
 
. : . : . : . : . : . :
JMFN018A05+ GTCTGCCCCATAGCCATGTGCCAGAACTAGTGTCTGCTTCCCACTCCCAACAATCC
JMFS030A05+ GTCTGCCCCATAGCCATGTGCCAGAACTAGTGTCTGCTTCCCACTCCCAACAATCCTTGC
JMFS017E06+ GTCTGCCCCATAGCCATGTGCCAGAACTAGTGTCTGCTTCCCACTCCCAACAATCCTTGC
                      ____________________________________________________________
consensus GTCTGCCCCATAGCCATGTGCCAGAACTAGTGTCTGCTTCCCACTCCCAACAATCCTTGC
 
. : . : . : . : . : . :
JMFS030A05+ ATTCATAGATAATCCCTTCTGCATCACCATTCTCGAGAAGAAGAGGGAGATATGAATATA
JMFS017E06+ ATTCATAGATAATCCCTTCTGCATCACCATTCTCGAGAAGAAGAGGGAGATATGAATATA
                      ____________________________________________________________
consensus ATTCATAGATAATCCCTTCTGCATCACCATTCTCGAGAAGAAGAGGGAGATATGAATATA