Previous Contig 002968:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018K18Sequence546007792 (2)gb:AY222338_15905882e-36Arabidopsis thaliana EXO70-G1 protein (EXO70-G1) mRNA, complete cds.728002968 (3)
JMFS016F04Sequence589002968 (3)
JMSF047J05Sequence657007792 (2)gb:AY222338_15905883e-42Arabidopsis thaliana EXO70-G1 protein (EXO70-G1) mRNA, complete cds.672002968 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018K18+ ATCCCAGGCCAGTGAGACAT
                      ____________________________________________________________
consensus ATCCCAGGCCAGTGAGACAT
 
. : . : . : . : . : . :
rJMFF018K18+ GGCAGTTTTAAAGTCCGGCAGCCTAGTGGAAAATTCAACAATAGCGTTACAGATCAGCTT
                      ____________________________________________________________
consensus GGCAGTTTTAAAGTCCGGCAGCCTAGTGGAAAATTCAACAATAGCGTTACAGATCAGCTT
 
. : . : . : . : . : . :
rJMFF018K18+ CCGAGTTNTCCTAACATGAAATAAATGGTTGAGGATTACTGGTAAGGCCATGGTTTAAAT
rJMSF047J05+ TCCTAACATGAAATAAATGGTTGAGGATTACTGGTAAGGCCATGGTTTAAAT
                      ____________________________________________________________
consensus CCGAGTTNTCCTAACATGAAATAAATGGTTGAGGATTACTGGTAAGGCCATGGTTTAAAT
 
. : . : . : . : . : . :
rJMFF018K18+ GAAAAAGGAACCTTGAAGTCCTACNCCTNTGTGTTGTAGANGTCATTGGTTACTTTGTAT
rJMSF047J05+ GAAAAAGGAACCTTGAAGTCCTACACCTCTGNGTTGTAGANGTCNTTGGTTACTTTGNAT
                      ____________________________________________________________
consensus GAAAAAGGAACCTTGAAGTCCTACACCTCTGTGTTGTAGANGTCATTGGTTACTTTGTAT
 
. : . : . : . : . : . :
rJMFF018K18+ ATAGTAAGTTTTNGTAGGATTTATTGNGGATCNCTTGGGCCAGCTTCAATTGAAGGAAAG
rJMSF047J05+ ATAGTAAGTTNTCGTAGGNTNTATTGTGGNTCNCTTGGGCCAGCTTCAATTGAAGGAAAG
JMFS016F04- GTAGGATCTATTGTGGATCACTTGGGCCAGCTTCAATTGAAGGAAAG
                      ____________________________________________________________
consensus ATAGTAAGTTTTCGTAGGATTTATTGTGGATCACTTGGGCCAGCTTCAATTGAAGGAAAG
 
. : . : . : . : . : . :
rJMFF018K18+ AAAAGCNCTTGTTTTTGATGGTTTTGACATGGGACTTTGGTTGCATGGNTTATGGGGGAA
rJMSF047J05+ AAAAGCNCTTGTTNTTGATGGTTTTGACNTGGGACTTTGGTTGCNTGGNTTATGGGGGAA
JMFS016F04- AAAAGCACTTGTTCTTGATGGTTTTGACATGGGACTTTGGTTGCATGGCTTATGGGGGAA
                      ____________________________________________________________
consensus AAAAGCACTTGTTTTTGATGGTTTTGACATGGGACTTTGGTTGCATGGCTTATGGGGGAA
 
. : . : . : . : . : . :
rJMFF018K18+ TTAATATCCNCGAAATTTTCAGGGAGCNCGTTACTTTTGAAGATAACCTGGCAAAACAAC
rJMSF047J05+ TTAATATCCCCGAAATTTTCAGGGNGCNCGTTACTNTTGAAGNTAACCTGGCAAAACAAC
JMFS016F04- TTAATATCCACGAAATTTTCAGGGAGCACGTTACTCTTGAAGATAACCTGGCAAAACAAC
                      ____________________________________________________________
consensus TTAATATCCCCGAAATTTTCAGGGAGCACGTTACTTTTGAAGATAACCTGGCAAAACAAC
 
. : . : . : . : . : . :
rJMFF018K18+ NCATTAATTNTTNCCTGGGCCCTTAAAGGTAAGATTTGAAGAAAACGTTTCCAGTTAATG
rJMSF047J05+ NCNTTAATTATTACCTGGGCCCTTAAAGGTAAGATTTGAAGAAAACGTTTCCNGTTAATG
JMFS016F04- ACATTAATTATTACCTGGGCCCTTAAAGGTAAGATTTGAAGAAAACGTTTCCAGTTAATG
                      ____________________________________________________________
consensus ACATTAATTATTACCTGGGCCCTTAAAGGTAAGATTTGAAGAAAACGTTTCCAGTTAATG
 
. : . : . : . : . : . :
rJMFF018K18+ NTATTTATTCCATTTTCCATCAAGAGNGTGGTCAGTCAGTCATTTTGCCNCAAGTTAAGC
rJMSF047J05+ CTATTTATTCCNTTTTCCNTCAAGNGNGNGGTCAGTCNGTCATTTTGCCNCAAGTTAAGC
JMFS016F04- CTATTTATTCCATTTTCCATCAAGAGTGTGGTCAGTCAGTCATTCTGCCACAAGTTAAGC
                      ____________________________________________________________
consensus CTATTTATTCCATTTTCCATCAAGAGTGTGGTCAGTCAGTCATTTTGCCACAAGTTAAGC
 
. : . : . : . : . : . :
rJMFF018K18+ AGNGGATACCTGTATTGCGGTTTGNTTGTCCATCACAATTATTAGGTCCGTGTTGNGTTT
rJMSF047J05+ NGNGGATACCTGTATTGCGGTNTGCTTGTCCNTCNCAATTATTAGGTCCGNGNTGNGTNT
JMFS016F04- AGTGGATACCTGTATTGCGGTCTGCTTGTCCATCACAATTATTAGGTCCGTGTTGCGTCT
                      ____________________________________________________________
consensus AGTGGATACCTGTATTGCGGTTTGCTTGTCCATCACAATTATTAGGTCCGTGTTGCGTTT
 
. : . : . : . : . : . :
rJMFF018K18+ AGAGCTTTAGCAGTAACNCCGTTCGCCCCAAAAAAAAAAACTGTGCTAGAACCTCTAGAT
rJMSF047J05+ AGAGCTTTAGCNGTAACCCCGTTCGCCCCAAAAAAAAAAACTGTGCTAGAACCTCTAGAT
JMFS016F04- AGAGCTTTAGCAGTAACACCGTTCGCCCCAAAAAAAAAAACTGTGCTAGAACCTCTAGAT
                      ____________________________________________________________
consensus AGAGCTTTAGCAGTAACCCCGTTCGCCCCAAAAAAAAAAACTGTGCTAGAACCTCTAGAT
 
. : . : . : . : . : . :
rJMFF018K18+ TTATTTGTTCATTGTGCCTCTAGCTGTATACAAGCTTACAAATGCCTTAATATGTCAATT
rJMSF047J05+ TTATTTGTTCATTGTGCCTCTAGCTGTATACAAGCTTACAAATGCCTTAATATGTCAATT
JMFS016F04- TTATTTGTTCATTGTGCCTCTAGCTGTATACAAGCTTACAAATGCCTTAATATGTCAATT
                      ____________________________________________________________
consensus TTATTTGTTCATTGTGCCTCTAGCTGTATACAAGCTTACAAATGCCTTAATATGTCAATT
 
. : . : . : . : . : . :
rJMFF018K18+ GTACTAAAGCCATGAGTCTCAGGGCAATAGTCTATTTCAATAATCAAT
rJMSF047J05+ GTACTAAAGCCATGAGTCTCAGGGCAATAGTCTATTTCAATAATCAATTCTTGCATTATG
JMFS016F04- GTACTAAAGCCATGAGTCTCAGGGCAATAGTCTATTTCAATAATCAATTCTTGCATTATG
                      ____________________________________________________________
consensus GTACTAAAGCCATGAGTCTCAGGGCAATAGTCTATTTCAATAATCAATTCTTGCATTATG
 
. : . : . : . : . : . :
rJMSF047J05+ TACTATTAATTGTTT
JMFS016F04- TACTATTAATTGTTTTGCACTTTTGCTTGTGAAAAATCACTGCAGAATTGATTGGTTCAT
                      ____________________________________________________________
consensus TACTATTAATTGTTTTGCACTTTTGCTTGTGAAAAATCACTGCAGAATTGATTGGTTCAT