Previous Contig 002966:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS014E01Sequence594002966 (4)sp|Q8LPB4|PSKR_DAUCA2e-27Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kin
JMFS016A12Sequence627002966 (4)sp|Q8LPB4|PSKR_DAUCA1e-23Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kin
JMFS016E09Sequence627002966 (4)sp|Q8LPB4|PSKR_DAUCA8e-17Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kin
JMSF019I20Sequence428002966 (4)sp|Q8LPB4|PSKR_DAUCA7e-15Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kin769022875sp|Q8LPB4|PSKR_DAUCA7e-78Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kin

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS014E01+ AAG
                      ____________________________________________________________
consensus AAG
 
. : . : . : . : . : . :
JMFS014E01+ CTGCTCCAAATTGCCTATAGATTCTGAAACTTTCCCATTAAGCCTCCTTTTCCCAAGGTC
JMFS016A12+ ACTTTCCCATTAAGCCTCCTTTTCCCAAGGTC
                      ____________________________________________________________
consensus CTGCTCCAAATTGCCTATAGATTCTGAAACTTTCCCATTAAGCCTCCTTTTCCCAAGGTC
 
. : . : . : . : . : . :
JMSF019I20+ ATCCAAGAGATAAAGAAGACTG
JMFS014E01+ CAATTTGATCACCCTTCCATAGTTTGAGGGCTCATTTAATCCAAGAGATAAAGAAGACTG
JMFS016A12+ CAATTTGATCACCCTTCCATAGTTTGAGGGCTCATTTAATCCAAGAGATAAAGAAGACTG
JMFS016E09+ ATCCAAGAGATAAAGAAGACTG
                      ____________________________________________________________
consensus CAATTTGATCACCCTTCCATAGTTTGAGGGCTCATTTAATCCAAGAGATAAAGAAGACTG
 
. : . : . : . : . : . :
JMSF019I20+ GCAAGTTATCCCAACCCAGTTGCAGCAATTGGGAGAAGAAGAAGAAGAAGAATTTCTCTC
JMFS014E01+ GCAAGTTATCCCAACCCAGTTGCAGCAATTGGGAGAAGAAGAAGAAGAAGAATTTCTCTC
JMFS016A12+ GCAAGTTATCCCAACCCAGTTGCAGCAATTGGGAGAAGAAGAAGAAGAAGAATTTCTCTC
JMFS016E09+ GCAAGTTATCCCAACCCAGTTGCAGCAATTGGGAGAAGAAGAAGAAGAAGAATTTCTCTC
                      ____________________________________________________________
consensus GCAAGTTATCCCAACCCAGTTGCAGCAATTGGGAGAAGAAGAAGAAGAAGAATTTCTCTC
 
. : . : . : . : . : . :
JMSF019I20+ CTAGCCATCAACACCAGACTCCAGTAAATCCAAGAACCCCTCCAGAGCTCTCAAATCCAC
JMFS014E01+ CCAGCCATCAACACCAGACTCCAGTAAATCCAAGAACCCCTCCAGAGCTCTCAAATCCAC
JMFS016A12+ CCAGCCATCAACACCAGACTCCAGTAAATCCAAGAACCCCTCCAGAGCTCTCAAATCCAC
JMFS016E09+ CCAGCCATCAACACCAGACTCCAGTAAATCCAAGAACCCCTCCAGAGCTCTCAAATCCAC
                      ____________________________________________________________
consensus CCAGCCATCAACACCAGACTCCAGTAAATCCAAGAACCCCTCCAGAGCTCTCAAATCCAC
 
. : . : . : . : . : . :
JMSF019I20+ CGGATTACATGTCAGCTTCTGGGGATTCTGGGCCTGAGATTCTGCAGAAACCCCAAGAAG
JMFS014E01+ CGGATTACATGTCAGCTTCTGGGGATTCTGGGCCTGAGATTCTGCAGAAACCCCAAGAAG
JMFS016A12+ CGGATTACATGTCAGCTTCTGGGGATTCTGGGCCTGAGATTCTGCAGAAACCCCAAGAAG
JMFS016E09+ CGGATTACATGTCAGCTTCTGGGGATTCTGGGCCTGAGATTCTGCAGAAACCCCAAGAAG
                      ____________________________________________________________
consensus CGGATTACATGTCAGCTTCTGGGGATTCTGGGCCTGAGATTCTGCAGAAACCCCAAGAAG
 
. : . : . : . : . : . :
JMSF019I20+ AATGAAAATCACACAAAGTATCACCAAACCCATCTCTTCTTCCCAAAAAAGCTCAAATCT
JMFS014E01+ AATGAAAATCACACAAAGTATCACCAAACCCATCTCTTCTTCCCAAAAAAGCTCAAATCT
JMFS016A12+ AATGAAAATCACACAAAGTATCACCAAACCCATCTCTTCTTCCCAAAAAAGCTCAAATCT
JMFS016E09+ AATGAAAATCACACAAAGTATCACCAAACCCATCTCTTCTTCCCAAAAAAGCTCAAATCT
                      ____________________________________________________________
consensus AATGAAAATCACACAAAGTATCACCAAACCCATCTCTTCTTCCCAAAAAAGCTCAAATCT
 
. : . : . : . : . : . :
JMSF019I20+ TTTTCACCAAAACTCCTCCTTTCTCAACATTTCGCCCCAAGATCAACTCAAAACACACAA
JMFS014E01+ TTTTCACCAAAACTCCTCCTTTCTCAACATTTCGCCCCAAGATCAACTCAAAACACACAA
JMFS016A12+ TTTTCACCAAAACTCCTCCTTTCTCAACATTTCGCCCCAAGATCAACTCAAAACACACAA
JMFS016E09+ TTTTCACCAAAACTCCTCCTTTCTCAACATTTCGCCCCAAGATCAACTCAAAACACACAA
                      ____________________________________________________________
consensus TTTTCACCAAAACTCCTCCTTTCTCAACATTTCGCCCCAAGATCAACTCAAAACACACAA
 
. : . : . : . : . : . :
JMSF019I20+ AGAACAGAAGCTTTGGGTAATTTGGCTTCAGCCCGAAGAAGAAGAAGAAGTTAAAAAGGA
JMFS014E01+ AGAACAGAAGCTTTGGGTAATTTGGCTTCAGCCCGAAGAAGAAGAAGAAGTTAAAAAGGA
JMFS016A12+ AGAACAGAAGCTTTGGGTAATTTGGCTTCAGCCCGAAGAAGAAGAAGAAGTTAAAAAGGA
JMFS016E09+ AGAACAGAAGCTTTGGGTAATTTGGCTTCAGCCCGAAGAAGAAGAAGAAGTTAAAAAGGA
                      ____________________________________________________________
consensus AGAACAGAAGCTTTGGGTAATTTGGCTTCAGCCCGAAGAAGAAGAAGAAGTTAAAAAGGA
 
. : . : . : . : . : . :
JMSF019I20+ AAAAAAGATTGAGGAGAAGCAGGAATGAAGGAAGAGAATTAGAA
JMFS014E01+ AAAAAAGATTGAGGAGAAGCAGGAATGAAGGAAGAGAATTAGAATATTCCCTTCAACCTT
JMFS016A12+ AAAAAAGATTGAGGAGAAGCAGGAATGAAGGAAGAGAATTAGAATATTCCCTTCAACCTT
JMFS016E09+ AAAAAAGATTGAGGAGAAGCAGGAATGAAGGAAGAGAATTAGAATATTCCCTTCAACCTT
                      ____________________________________________________________
consensus AAAAAAGATTGAGGAGAAGCAGGAATGAAGGAAGAGAATTAGAATATTCCCTTCAACCTT
 
. : . : . : . : . : . :
JMFS014E01+ CGTTTAATGGTCTAAATAGGAGACGGCTGACGCTGCGTTCTGCTCTCCAAA
JMFS016A12+ CGTTTAATGGTCTAAATAGGAGACGGCTGACGCTGCGTTCTGCTCTCCAAATTGAAGACT
JMFS016E09+ CGTTTAATGGTCTAAATAGGAGACGGCTGACGCTGCGTTCTGCTCTCCAAATTGAAGACT
                      ____________________________________________________________
consensus CGTTTAATGGTCTAAATAGGAGACGGCTGACGCTGCGTTCTGCTCTCCAAATTGAAGACT
 
. : . : . : . : . : . :
JMFS016A12+ TTTGT
JMFS016E09+ TTTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTATGAACTATGAAGAAGCCGTTG
                      ____________________________________________________________
consensus TTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGAACTATGAAGAAGCCGTTG
 
. : . : . : . : . : . :
JMFS016E09+ GGAGGGAGAGGTTGAATATCTGTTAAACATAATTAATTTATAAGAACAGTCATCATCTTC
                      ____________________________________________________________
consensus GGAGGGAGAGGTTGAATATCTGTTAAACATAATTAATTTATAAGAACAGTCATCATCTTC