Previous Contig 002965:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS016E08Sequence605002965 (2)gb:AY136369_15818704e-61Arabidopsis thaliana putative epsilon-adaptin (At1g31730) mRNA, complete cds.>gb
JMFS144F09Sequence600002965 (2)gb:AY136369_15818702e-84Arabidopsis thaliana putative epsilon-adaptin (At1g31730) mRNA, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS144F09+ CATTACAGCTTTTTTCC
                      ____________________________________________________________
consensus CATTACAGCTTTTTTCC
 
. : . : . : . : . : . :
JMFS144F09+ TAACAGCCTCCTTGGCGTGTCCCAGCAGCTCCACCACTTGAGGCAACACAGCGGGGATTG
                      ____________________________________________________________
consensus TAACAGCCTCCTTGGCGTGTCCCAGCAGCTCCACCACTTGAGGCAACACAGCGGGGATTG
 
. : . : . : . : . : . :
JMFS144F09+ TGTCCTCATTAATCAACTTACAAACAGCATTCAATGCCGAGCAAACGACCAAGTAATTAT
JMFS016E08+ ATTAT
                      ____________________________________________________________
consensus TGTCCTCATTAATCAACTTACAAACAGCATTCAATGCCGAGCAAACGACCAAGTAATTAT
 
. : . : . : . : . : . :
JMFS144F09+ CCGACTTCAAGTCCTTCTGGATCGTGTTTACAATCAAGATAATCAAATCATGGTCCTCGT
JMFS016E08+ CCGACTTCAAGTCCTTCTGGATCGTGTTTACAATCAAGATAATCAAATCATGGTCCTCGT
                      ____________________________________________________________
consensus CCGACTTCAAGTCCTTCTGGATCGTGTTTACAATCAAGATAATCAAATCATGGTCCTCGT
 
. : . : . : . : . : . :
JMFS144F09+ TCAGAAACAAGGTCACGGCAAGGTACCCGGTTCTCTTGTGCAGCAAAGTATCATCGTGCG
JMFS016E08+ TCAGAAACAAGGTCACGGCAAGGTACCCGGTTCTCTTGTGCAGCAAAGTATCATCGTGCG
                      ____________________________________________________________
consensus TCAGAAACAAGGTCACGGCAAGGTACCCGGTTCTCTTGTGCAGCAAAGTATCATCGTGCG
 
. : . : . : . : . : . :
JMFS144F09+ TCATCTTAACGGCGTGAATGTAGCCGAACGAAGCGTCGTGGCCAAGCATCTCCACATACA
JMFS016E08+ TCATCTTAACGGCGTGAATGTAGCCGAACGAAGCGTCGTGGCCAAGCATCTCCACATACA
                      ____________________________________________________________
consensus TCATCTTAACGGCGTGAATGTAGCCGAACGAAGCGTCGTGGCCAAGCATCTCCACATACA
 
. : . : . : . : . : . :
JMFS144F09+ CAAGCCGCATTATGAATTCCTTCATCTTCCGCTTCGGGATATCAGGCTCTACGATGCGGC
JMFS016E08+ CAAGCCGCATTATGAATTCCTTCATCTTCCGCTTCGGGATATCAGGCTCTACGATGCGGC
                      ____________________________________________________________
consensus CAAGCCGCATTATGAATTCCTTCATCTTCCGCTTCGGGATATCAGGCTCTACGATGCGGC
 
. : . : . : . : . : . :
JMFS144F09+ GCTTCAGGGTCTCGATCTCATTGCGAACAATGCGGTCTTCTTCCGCCTTGGATCTGGCTT
JMFS016E08+ GCTTCAGGGTCTCGATCTCATTGCGAACAATGCGGTCTTCTTCCGCCTTGGATCTGGCTT
                      ____________________________________________________________
consensus GCTTCAGGGTCTCGATCTCATTGCGAACAATGCGGTCTTCTTCCGCCTTGGATCTGGCTT
 
. : . : . : . : . : . :
JMFS144F09+ CGCCGATGGCCTTGATCAGGTCCAAGAACTCCTTCGACTGCCCGAACCCGCCTTGGGAGC
JMFS016E08+ CGCCGATGGCCTTGATCAGGTCCAAGAACTCGTTCGACTGCCCGAACCCGCCTTGGGAGC
                      ____________________________________________________________
consensus CGCCGATGGCCTTGATCAGGTCCAAGAACTCGTTCGACTGCCCGAACCCGCCTTGGGAGC
 
. : . : . : . : . : . :
JMFS144F09+ CCATTGCGAGCTCCAGTCCGATTGTCTTCAACTGCTCCA
JMFS016E08+ CCATTGCGAGCTCCAGTCCGATTGTCTTCAACTGCTCCAXXXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus CCATTGCGAGCTCCAGTCCGATTGTCTTCAACTGCTCCANNNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFS016E08+ XXCAGAACGAACAATGCCAAGTTTTATTCGGTAGAAATCATGAGATTTTACGTTCCTCGA
                      ____________________________________________________________
consensus NNCAGAACGAACAATGCCAAGTTTTATTCGGTAGAAATCATGAGATTTTACGTTCCTCGA
 
. : . : . : . : . : . :
JMFS016E08+ TTCAGATCGAGGATTGAAACCGATAATAATTTTAGGTTTGAAGATTGGGGAATTTCTGGT
                      ____________________________________________________________
consensus TTCAGATCGAGGATTGAAACCGATAATAATTTTAGGTTTGAAGATTGGGGAATTTCTGGT
 
. : . : . : . : . : . :
JMFS016E08+ GATATCTCTATTCTCTAATGCCAACTCTGCTGTAGATCGATGCCCGGGAAAGTGACACGT
                      ____________________________________________________________
consensus GATATCTCTATTCTCTAATGCCAACTCTGCTGTAGATCGATGCCCGGGAAAGTGACACGT