Previous Contig 002963:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS016C06Sequence557002963 (2)gb:AK117901_18159094e-29Arabidopsis thaliana At5g49660 mRNA for putative receptor protein kinase, comple
JMFS128G07Sequence618002963 (2)gb:AK117901_18159092e-35Arabidopsis thaliana At5g49660 mRNA for putative receptor protein kinase, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS128G07+ TGAGCTTTGTAAGCCCAG
                      ____________________________________________________________
consensus TGAGCTTTGTAAGCCCAG
 
. : . : . : . : . : . :
JMFS128G07+ AAATGGCGTCCGGTAGTTGCCACTGGTTAAAGCCGCAGTTTTCGTTGAAGTTGAGGACCC
JMFS016C06+ GTTGAAGTTGAGGACCC
                      ____________________________________________________________
consensus AAATGGCGTCCGGTAGTTGCCACTGGTTAAAGCCGCAGTTTTCGTTGAAGTTGAGGACCC
 
. : . : . : . : . : . :
JMFS128G07+ GGAGCTCGGTGAGATTGGCCACCGACGTCGGAAACTCGCCGGTGAAGAGATTGTAGGAGA
JMFS016C06+ GGAGCTCGGTGAGATTGGCCACCGACGTCGGAAACTCGCCGGTGAAGAGATTGTAGGAGA
                      ____________________________________________________________
consensus GGAGCTCGGTGAGATTGGCCACCGACGTCGGAAACTCGCCGGTGAAGAGATTGTAGGAGA
 
. : . : . : . : . : . :
JMFS128G07+ GATCAAGCAACCTCAGAGCCCGCAACGGCGTCAAATCCGGCAATGTTCCCGCCAGATACG
JMFS016C06+ GATCAAGCAACCTCAGAGCCCGCAACGGCGTCAAATCCGGCAATGTTCCCGCCAGATACG
                      ____________________________________________________________
consensus GATCAAGCAACCTCAGAGCCCGCAACGGCGTCAAATCCGGCAATGTTCCCGCCAGATACG
 
. : . : . : . : . : . :
JMFS128G07+ TAGCCGACATGTTCAGCTCTTCCAAGAAAGAGCAGTTGGTGATTCTGGCCGGAAAGTAAC
JMFS016C06+ TAGCCGACATGTTCAGCTCTTCCAAGAAAGAGCAGTTGGTGATTCTGGCCGGAAAGTAAC
                      ____________________________________________________________
consensus TAGCCGACATGTTCAGCTCTTCCAAGAAAGAGCAGTTGGTGATTCTGGCCGGAAAGTAAC
 
. : . : . : . : . : . :
JMFS128G07+ TCCCATGGAAGTGATTCTGGCCGAGTTTAAGAATCCTCAGCTCCGGCAAATAACTACAAA
JMFS016C06+ TCCCATGGAAGTGATTCTGGCCGAGTTTAAGAATCCTCAGCTCCGGCAAATAACTACAAA
                      ____________________________________________________________
consensus TCCCATGGAAGTGATTCTGGCCGAGTTTAAGAATCCTCAGCTCCGGCAAATAACTACAAA
 
. : . : . : . : . : . :
JMFS128G07+ CATCCCCCGGAAACCGGCCGGATAATCCCCACCGGCTGATATCAATCTTCACAACATAAC
JMFS016C06+ CATCCCCCGGAAACCGGCCGGATAATCCCCACCGGCTGATATCAATCTTCACAACATAAC
                      ____________________________________________________________
consensus CATCCCCCGGAAACCGGCCGGATAATCCCCACCGGCTGATATCAATCTTCACAACATAAC
 
. : . : . : . : . : . :
JMFS128G07+ CTCGATTATCACACCCAATCCCGGAATAATTGCAGAACGGTTTCCCATCCCAACCAGCCA
JMFS016C06+ CTCGATTATCACACCCAATCCCGGAATAATTGCAGAACGGTTTCCCATCCCAACCAGCCA
                      ____________________________________________________________
consensus CTCGATTATCACACCCAATCCCGGAATAATTGCAGAACGGTTTCCCATCCCAACCAGCCA
 
. : . : . : . : . : . :
JMFS128G07+ AGAAATCCCCTGTCAGAGACTTCTTCACAACATCAAAGAACTCACCCTGCTTCTCCACAC
JMFS016C06+ AGAAATCCCCTGTCAGAGACTTCTTCACAACATCAAAGAACTCACCCTGCTTCTCCACAC
                      ____________________________________________________________
consensus AGAAATCCCCTGTCAGAGACTTCTTCACAACATCAAAGAACTCACCCTGCTTCTCCACAC
 
. : . : . : . : . : . :
JMFS128G07+ TCCCCTCATACCCATCCGCCACTGCTAAAAACAGCAAAAGGAAGAAGATGACAGCTCGCT
JMFS016C06+ TCCCCTCATACCCATCCGCCACTGCTAAAAACAGCAAAAGGAAGAAGATGACAGCTCGCT
                      ____________________________________________________________
consensus TCCCCTCATACCCATCCGCCACTGCTAAAAACAGCAAAAGGAAGAAGATGACAGCTCGCT
 
. : . : . : . : . : . :
JMFS128G07+ GAGCAGCCATTAAAGATCTGATCTTTAACCCCACAGTAGAGAGATGAAGGGGGAATATAA
JMFS016C06+ GAGCAGCCATTAAAGATCTGATCTTTAACCCCACAGTAGAGAGATGAAGGGGGAATATAA
                      ____________________________________________________________
consensus GAGCAGCCATTAAAGATCTGATCTTTAACCCCACAGTAGAGAGATGAAGGGGGAATATAA