Previous Contig 002949:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS005G05Sequence369002949 (2)
JMFS014G10Sequence639002949 (2)gb:SLU32444_17153824e-63Solanum lycopersicum phytochrome F (PHYF) gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS005G05- CTGCTTCAGTCCATGCTCAAAGGT
                      ____________________________________________________________
consensus CTGCTTCAGTCCATGCTCAAAGGT
 
. : . : . : . : . : . :
JMFS005G05- TAAGAATCAGGAAAGTCATATACAGGTTGCTGGTTTAACTCAATTACCAGCAGAAAATTC
                      ____________________________________________________________
consensus TAAGAATCAGGAAAGTCATATACAGGTTGCTGGTTTAACTCAATTACCAGCAGAAAATTC
 
. : . : . : . : . : . :
JMFS005G05- CTGATTCCAGGTAATACTGTACAAGGCAGAATGTTCGGTTGCTTTCAATGGAGGAACCAC
                      ____________________________________________________________
consensus CTGATTCCAGGTAATACTGTACAAGGCAGAATGTTCGGTTGCTTTCAATGGAGGAACCAC
 
. : . : . : . : . : . :
JMFS005G05- AAATGGGCCGAAACCCTTTGCTGCAGATGCAGATGCAACATTACTGCCATTTTGTTTATC
                      ____________________________________________________________
consensus AAATGGGCCGAAACCCTTTGCTGCAGATGCAGATGCAACATTACTGCCATTTTGTTTATC
 
. : . : . : . : . : . :
JMFS005G05- AACTCGAGCCTGGTTTTGCACCACCTCATTCTTTATTATGGTTGTTGCTGAAGAGGACGA
                      ____________________________________________________________
consensus AACTCGAGCCTGGTTTTGCACCACCTCATTCTTTATTATGGTTGTTGCTGAAGAGGACGA
 
. : . : . : . : . : . :
JMFS005G05- GGCAGATCGGGCAAGCCATGATGTTTGAGTACTCGTCTGCCATAATTAAGGTGCAGTTTC
JMFS014G10+ TGTTTGAGTACTCGTCTGCCATAATTAAGGTGCAGTTTC
                      ____________________________________________________________
consensus GGCAGATCGGGCAAGCCATGATGTTTGAGTACTCGTCTGCCATAATTAAGGTGCAGTTTC
 
. : . : . : . : . : . :
JMFS005G05- TCCCCAAGCAGGCGGTGAGCACACTGATGATTGAAGTTATTGATG
JMFS014G10+ TCCCCAAGCAGGCGGTGAGCACACTGATGATTGAAGTTATTGATGGTCGCTTCTTAGAGA
                      ____________________________________________________________
consensus TCCCCAAGCAGGCGGTGAGCACACTGATGATTGAAGTTATTGATGGTCGCTTCTTAGAGA
 
. : . : . : . : . : . :
JMFS014G10+ TGCCGGAAATTCTAGTAATATTATGAATGATGACCTCTCTGCCTCTCGAAGATACTGTAC
                      ____________________________________________________________
consensus TGCCGGAAATTCTAGTAATATTATGAATGATGACCTCTCTGCCTCTCGAAGATACTGTAC
 
. : . : . : . : . : . :
JMFS014G10+ AGTGCCATTCATAATTTTAATAAGTTTCTGGCTTATATACAACCCAAGACCTTCCCTCGA
                      ____________________________________________________________
consensus AGTGCCATTCATAATTTTAATAAGTTTCTGGCTTATATACAACCCAAGACCTTCCCTCGA
 
. : . : . : . : . : . :
JMFS014G10+ CATGCTTTGTTTATAGTTGAACATTTCCTGGATTAGCTCTTCTGGAATTCCCGGGGCTGG
                      ____________________________________________________________
consensus CATGCTTTGTTTATAGTTGAACATTTCCTGGATTAGCTCTTCTGGAATTCCCGGGGCTGG
 
. : . : . : . : . : . :
JMFS014G10+ ATGTGTGATCCGAAATTCAAGATGCACTACATGCATCTTGGCTCCAATCTGCTCCCTTCT
                      ____________________________________________________________
consensus ATGTGTGATCCGAAATTCAAGATGCACTACATGCATCTTGGCTCCAATCTGCTCCCTTCT
 
. : . : . : . : . : . :
JMFS014G10+ TGCAATAATTCTGAATAGAACGGATGATTCTTCAAAAAGAGGTGTAAAGAGTACAGCAGT
                      ____________________________________________________________
consensus TGCAATAATTCTGAATAGAACGGATGATTCTTCAAAAAGAGGTGTAAAGAGTACAGCAGT
 
. : . : . : . : . : . :
JMFS014G10+ TGTCAAGAAGTCTGAGAGCACTTGTTGAATCCTCAAATTGTCTCCAAACAAGTACAAGGA
                      ____________________________________________________________
consensus TGTCAAGAAGTCTGAGAGCACTTGTTGAATCCTCAAATTGTCTCCAAACAAGTACAAGGA
 
. : . : . : . : . : . :
JMFS014G10+ TGATGCTTCAACAGGTAAATCGCACATGATCTGCACCTGGATCTCCCGACTTGGAATCAT
                      ____________________________________________________________
consensus TGATGCTTCAACAGGTAAATCGCACATGATCTGCACCTGGATCTCCCGACTTGGAATCAT
 
. : . : . : . : . : . :
JMFS014G10+ AGCTTGATTTACGACTGCTTTAATAGCCTCACCAAGACTGAACTCGCAACAGTTCATTTC
                      ____________________________________________________________
consensus AGCTTGATTTACGACTGCTTTAATAGCCTCACCAAGACTGAACTCGCAACAGTTCATTTC
 
. : . : . : . : . : . :
JMFS014G10+ CGTATAGCTTTCTTCAATACTTTCAATATCGGTATCATCAATGATCTTAGCCAGCTGTTC
                      ____________________________________________________________
consensus CGTATAGCTTTCTTCAATACTTTCAATATCGGTATCATCAATGATCTTAGCCAGCTGTTC