Previous Contig 002945:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS014C03Sequence580002945 (2)gb:AB009054_15107262e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUL8.
JMFS071D06Sequence626002945 (2)gb:AB009054_15107267e-80Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUL8.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS071D06+ TTGCTGATAAGGGGTCATTCACTGGAAAAGAGCTCTTT
                      ____________________________________________________________
consensus TTGCTGATAAGGGGTCATTCACTGGAAAAGAGCTCTTT
 
. : . : . : . : . : . :
JMFS071D06+ GATAAGAGGTTAGCAAAGTCTTCAAAAATATTGCTGCAGGATATATCACAGTCAAAATTG
                      ____________________________________________________________
consensus GATAAGAGGTTAGCAAAGTCTTCAAAAATATTGCTGCAGGATATATCACAGTCAAAATTG
 
. : . : . : . : . : . :
JMFS071D06+ GCATACATCTCTGTCATGAACATATGCTGCCGGCAGAAATCAACAAGAGTTTCCATAGCA
                      ____________________________________________________________
consensus GCATACATCTCTGTCATGAACATATGCTGCCGGCAGAAATCAACAAGAGTTTCCATAGCA
 
. : . : . : . : . : . :
JMFS071D06+ ACCTCCTGCAGTTGGTATGAAGTGTCATGCTTACTATGTGCTATCCTCAAAAGCACACCA
JMFS014C03+ ATCCTCAAGAGCACACCA
                      ____________________________________________________________
consensus ACCTCCTGCAGTTGGTATGAAGTGTCATGCTTACTATGTGCTATCCTCAAGAGCACACCA
 
. : . : . : . : . : . :
JMFS071D06+ GAGAAAAAAGCTTCAAGTTGTAGTTTCAACTTAGTACGTAGATGATGATATAAATTAAGA
JMFS014C03+ GAGAAAAATGTTTCAAGCTGCAGCTTTAGTTTAGCACGGAGATGATGATAAAGATTGAGA
                      ____________________________________________________________
consensus GAGAAAAATGTTTCAAGTTGTAGTTTTAGTTTAGTACGTAGATGATGATATAGATTGAGA
 
. : . : . : . : . : . :
JMFS071D06+ ACGATGCTACAAACTGTTGAAAGGATTAGTGGACTCATCGACAAGCCAAAGCGCATCAAG
JMFS014C03+ ACAATGCTAGTAACTGTTGAAAGGATTAGGGGACTCATCGACAAGCCAAAGCGCATCAAA
                      ____________________________________________________________
consensus ACGATGCTAGTAACTGTTGAAAGGATTAGTGGACTCATCGACAAGCCAAAGCGCATCAAG
 
. : . : . : . : . : . :
JMFS071D06+ TTATGGAATAGCTCCTCCTGTATCAGGGACAATAATTCTGGATGACTTCCAAAAGAATCA
JMFS014C03+ GTTTGGAATAACTCCTCCTGTATCAGGGCCAATAATTTTGGATGGCTACCAAAAGAAGCC
                      ____________________________________________________________
consensus TTTTGGAATAGCTCCTCCTGTATCAGGGCCAATAATTTTGGATGGCTTCCAAAAGAATCC
 
. : . : . : . : . : . :
JMFS071D06+ CCACCTAATTCTATTGCTGAATTAATTAAACCCAGTGCAAAAAGGGGAACATCTTCATCA
JMFS014C03+ CCACCTATTTCTATTGCTGAATTAATTAAGCCCAGTGCAAAAAGGGGAACATCCTCGTCA
                      ____________________________________________________________
consensus CCACCTATTTCTATTGCTGAATTAATTAAGCCCAGTGCAAAAAGGGGAACATCTTCGTCA
 
. : . : . : . : . : . :
JMFS071D06+ TATGCTATAGCATTCAATCTGGGACCAATTTCCATGTGATCCAACACATTCAGAAGGGAG
JMFS014C03+ TATGCTATAGGGTTGGATCTTGGACTAATTTCCATGTGATCCATCACATTCAGAAGGGAA
                      ____________________________________________________________
consensus TATGCTATAGGGTTGGATCTTGGACTAATTTCCATGTGATCCATCACATTCAGAAGGGAG
 
. : . : . : . : . : . :
JMFS071D06+ CACAGGAAATGAAGTATCTCCACCATGCAAGGGATTCCATAAGGTTCCATCATGGATCGC
JMFS014C03+ CATAGGAAATGAAGTATCTCCACCATGCAAGGGATCCCATAAGGATCCATCATGGAAAGC
                      ____________________________________________________________
consensus CATAGGAAATGAAGTATCTCCACCATGCAAGGGATTCCATAAGGTTCCATCATGGATCGC
 
. : . : . : . : . : . :
JMFS071D06+ TCTCCACTATTAGAATTCTCTTTCCTATGGCCAACCT
JMFS014C03+ CCTCCACCATTAGCAATCTCCTTCCTCTGGCCAACCTTTTCATCCTTGCTTGCCAACGGG
                      ____________________________________________________________
consensus TCTCCACTATTAGCATTCTCTTTCCTCTGGCCAACCTTTTCATCCTTGCTTGCCAACGGG
 
. : . : . : . : . : . :
JMFS014C03+ TCTGAGGATACATTTGAAGGAGCCACATTAACAGAACCTTCATCCGATGGTGCCTTGTGA
                      ____________________________________________________________
consensus TCTGAGGATACATTTGAAGGAGCCACATTAACAGAACCTTCATCCGATGGTGCCTTGTGA
 
. : . : . : . : . : . :
JMFS014C03+ TTAGATTCTGCATTAACAGAACCACTGTCAGATTGTCCATCCCCAGAAGTTTGACCTTCC
                      ____________________________________________________________
consensus TTAGATTCTGCATTAACAGAACCACTGTCAGATTGTCCATCCCCAGAAGTTTGACCTTCC