Previous Contig 002941:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS013H09Sequence579002941 (4)gb:AC020580_15385291e-08Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>
JMFS014G08Sequence561002941 (4)gb:AY059769_15646211e-13Arabidopsis thaliana putative protein kinase (At1g67890) mRNA, complete cds.
JMFS053A12Sequence515002941 (4)gb:AC020580_15385290.026Arabidopsis thaliana chromosome 3 BAC F5E6 genomic sequence, complete sequence.>
JMFS151A08Sequence579002941 (4)gb:AY059769_15646212e-14Arabidopsis thaliana putative protein kinase (At1g67890) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS151A08+ CGACACCACAGCTTTCGCCGCCGTCATCGCCTCTATACACGTCTTTACTACTACTCTCC
JMFS014G08+ GCCGTCATCGCCTCTATACACGTCTTTACTACTACTCTCC
                      ____________________________________________________________
consensus CGACACCACAGCTTTCGCCGCCGTCATCGCCTCTATACACGTCTTTACTACTACTCTCC
 
. : . : . : . : . : . :
JMFS151A08+ CTCTGCAGCGGAGAAGAATGTCGAAATGAGGCAGAACCCCTTTTCCACACAGCCATAGCG
JMFS014G08+ CTCTGCAGCGGAGAAGAATGTCGAAATGAGGCAGAACCCCTTTTCCACACAGCCATAGCG
JMFS053A12+ GCAGAACCCCTTTTCCACACAGCCATAGCG
JMFS013H09+ CGAAATGAGGCAGAACCCCTTTTCCACACAGCCATAGCG
                      ____________________________________________________________
consensus CTCTGCAGCGGAGAAGAATGTCGAAATGAGGCAGAACCCCTTTTCCACACAGCCATAGCG
 
. : . : . : . : . : . :
JMFS151A08+ CCACCCTCAAATCCACCATGCCTTCCGCCGCCACCAAGCTTCAACCGCCGCGGCCGTTGC
JMFS014G08+ CCACCCTCAAATCCACCATGCCTTCCGCCGCCACCAAGCTTCAACCGCCGCGGCCGTTGC
JMFS053A12+ CCACCCTCAAATCCACCATGCCTTCCGCCGTCANCAAGTTTCAACCGCCGCGGCCGTTGN
JMFS013H09+ CCACCCTCAAATCCACCATGCCTTCCGCCGCCACCAAGCTTCAACCGCCGCGGCCGTTGC
                      ____________________________________________________________
consensus CCACCCTCAAATCCACCATGCCTTCCGCCGCCACCAAGCTTCAACCGCCGCGGCCGTTGC
 
. : . : . : . : . : . :
JMFS151A08+ GGGGAGATAGAGTGTGACCTTTGTCTCTCTGATCTGTAATCGTTCGAAACCATGAGCTTC
JMFS014G08+ GGGGAGATAGAGTGTGACCTTTGTCTCTCTGATCTGTAATCGTTCGAAACCATGAGCTTC
JMFS053A12+ GGGGAGATAGAGTGTGACCTTTGTCTCTCTGATCTGTAATCGTTCGAAACCATGAGCTTC
JMFS013H09+ GGGGAGATAGAGTGTGACCTTTGTCTCTCTGATCTGTAATCGTTCGAAACCATGAGCTTC
                      ____________________________________________________________
consensus GGGGAGATAGAGTGTGACCTTTGTCTCTCTGATCTGTAATCGTTCGAAACCATGAGCTTC
 
. : . : . : . : . : . :
JMFS151A08+ GACATCTCCTCTTTCAAGCGCGCATGCCCTGCCTCCAGCTCCTGGATCTTCTTTAGCAGC
JMFS014G08+ GACATCTCCTCTTTCAAGCGCGCATGCCCTGCCTCCAGCTCCTGGATCTTCTTTAGCAGC
JMFS053A12+ GACATCTCCTCTTTCAAGCGCGCATGCCCTGCCTCCAGCTCCNGGATCTTCTTTAGCAGC
JMFS013H09+ GACATCTCCTCTTTCAAGCGCGCATGCCCTGCCTCCAGCTCCTGGATCTTCTTTAGCAGC
                      ____________________________________________________________
consensus GACATCTCCTCTTTCAAGCGCGCATGCCCTGCCTCCAGCTCCTGGATCTTCTTTAGCAGC
 
. : . : . : . : . : . :
JMFS151A08+ TCCTCCGCTGGCGGTACCTGTGACGGCGGCTCAGCTGATGCTGTTGTATTTTCCATTGCA
JMFS014G08+ TCCTCCGCTGGCGGTACCTGTGACGGCGGCTCAGCTGATGCTGTTGTATTTTCCATTGCA
JMFS053A12+ TCTTCCGCTGGCGGTACCTGTGACGGCGGCTCAGCTGATGCTGTTGTATTTTCCANTGCA
JMFS013H09+ TCCTCCGCTGGCGGTACCTGTGACGGCGGCTCAGCTGATGCTGTTGTATTTTCCATTGCA
                      ____________________________________________________________
consensus TCCTCCGCTGGCGGTACCTGTGACGGCGGCTCAGCTGATGCTGTTGTATTTTCCATTGCA
 
. : . : . : . : . : . :
JMFS151A08+ ATTCGACTTTAAAAAAAAAAAAAAAATCAAAATTCCACCGAGCTAATATTCTCTATATCC
JMFS014G08+ ATTCGACTTTAAAAAAAAAAAAAAAATCAAAATTCCACCGAGCTAATATTCTCTATATCC
JMFS053A12+ ATTCGACTTT-AAAAAAAAAAAAAAATCAAAATTCCACCGAGCTAATATTCTCTATATCC
JMFS013H09+ ATTCGACTTTAAAAAAAAAAAAAAAATCAAAATTCCACCGAGCTAATATTCTCTATATCC
                      ____________________________________________________________
consensus ATTCGACTTTAAAAAAAAAAAAAAAATCAAAATTCCACCGAGCTAATATTCTCTATATCC
 
. : . : . : . : . : . :
JMFS151A08+ AAGTTGACTCTCTTCTCTCGCCCCCTCGCTACACATATTTATGGAAGAATTGATTGAATG
JMFS014G08+ AAGTTGACTCTCTTCTCTCGCCCCCTCGCTACACATATTTATGGAAGAATTGATTGAATG
JMFS053A12+ AAGTTGACTCTCTTCTCTCGCCCCCTCGCTACACATATTTATGGAAGAATTGATTGAATG
JMFS013H09+ AAGTTGACTCTCTTCTCTCGCCCCCTCGCTACACATATTTATGGAAGAATTGATTGAATG
                      ____________________________________________________________
consensus AAGTTGACTCTCTTCTCTCGCCCCCTCGCTACACATATTTATGGAAGAATTGATTGAATG
 
. : . : . : . : . : . :
JMFS151A08+ GATCTACAGCTACAATCGCTTGTGGCCTTGATTACCTATGAACAAAATTGTAGCTAAAAT
JMFS014G08+ GATCTACAGCTACAATCGCTTGTGGCCTTGATTACCTATGAACAAAATTGTAGCTAAAAT
JMFS053A12+ GATCTACAGCTACAATCGCTTGTGGCCTTGATTACCTATGAACAAAATTGTAGCTAAAAT
JMFS013H09+ GATCTACAGCTACAATCGCTTGTGGCCTTGATTACCTATGAACAAAATTGTAGCTAAAAT
                      ____________________________________________________________
consensus GATCTACAGCTACAATCGCTTGTGGCCTTGATTACCTATGAACAAAATTGTAGCTAAAAT
 
. : . : . : . : . : . :
JMFS151A08+ GAAGAAACTGTGAGCTGAGGAAGCCGCCTTTTTGCGATTT
JMFS014G08+ GAAGAAACTGTGAGCTGAGGAAGCCGCCTTTTTGCGATTT
JMFS053A12+ GAAGAAACTGTGAGCTGAGGAAGCCGCCCTTTTGCGATTT
JMFS013H09+ GAAGAAACTGTGAGCTGAGGAAGCCGCCTTTTTGCGATTTXXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus GAAGAAACTGTGAGCTGAGGAAGCCGCCTTTTTGCGATTTNNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFS013H09+ XXXXXXXXXXXXXXXXXXXXXXACTCGTCGTTATTCTCTGTACGCTGTAGCTTATTGCGC
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNACTCGTCGTTATTCTCTGTACGCTGTAGCTTATTGCGC