Previous Contig 002935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019H03Sequence545002935 (8)sp|P30924|GLGB_SOLTU1e-461,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz715003614 (5)gb:STY08786_17231867e-47Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.
JMFS013A07Sequence608002935 (8)sp|P30924|GLGB_SOLTU1e-351,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz
JMFS043F06Sequence600002935 (8)sp|P30924|GLGB_SOLTU5e-451,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz
JMFS048D07Sequence470002935 (8)sp|P30924|GLGB_SOLTU2e-141,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz
JMFS078D12Sequence619002935 (8)sp|P30924|GLGB_SOLTU2e-761,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz
JMFS146F01Sequence616002935 (8)sp|P30924|GLGB_SOLTU4e-621,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz
JMSF011L01Sequence433002935 (8)sp|P30924|GLGB_SOLTU1e-151,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz744003614 (5)gb:STY08786_17231862e-46Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.
JMSF018D09Sequence218002935 (8)796003614 (5)gb:STY08786_17231863e-49Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS078D12+ ATCCAAGCCG
                      ____________________________________________________________
consensus ATCCAAGCCG
 
. : . : . : . : . : . :
JMFS078D12+ GGATCCTATCAATCCAAACACCACTGTTGTGCTTGAAACGGAACTTAACTCTAGAGTTGT
                      ____________________________________________________________
consensus GGATCCTATCAATCCAAACACCACTGTTGTGCTTGAAACGGAACTTAACTCTAGAGTTGT
 
. : . : . : . : . : . :
JMFS078D12+ GTGGAATAGCTGGCTTTCCATCACAATCAGGAATTTTTATGCTCCATACACCAAATTGGT
JMFS146F01+ AATCAGGAATTTTTATGCTCCATACACCAAATTGGT
                      ____________________________________________________________
consensus GTGGAATAGCTGGCTTTCCATCACAATCAGGAATTTTTATGCTCCATACACCAAATTGGT
 
. : . : . : . : . : . :
JMFS078D12+ TCTTCTCCATCTTGTGACTGGACCCATCCCACTCATTGAAATCACCAATAATTTCTGCTT
JMFS146F01+ TCTTCTCCATCTTGTGACTGGACCCATCCCACTCATTGAAATCACCAATAATTTCTGCTT
JMFF019H03+ TTTCTGCTT
                      ____________________________________________________________
consensus TCTTCTCCATCTTGTGACTGGACCCATCCCACTCATTGAAATCACCAATAATTTCTGCTT
 
. : . : . : . : . : . :
JMFS078D12+ CCTGAGCAGCAGGGGCCCATTCCTGATAGACAATGCAGCCTTCTTCTTTGTTAAACCCAA
JMFS146F01+ CCTGAGCAGCAGGGGCCCATTCCTGATAGACAATGCAGCCTTCTTCTTTGTTAAACCCAA
JMFS048D07+ CTTTGTTAAACCCAA
JMFF019H03+ CCTGAGCAGCAGGGGCCCATTCCTGATAGACAATGCAGCCTTCTTCTTTGTTAAACCCAA
JMFS043F06+ GAGCAGCAGGGGCCCATTCCTGATAGACAATGCAGCCTTCTTCTTTGTTAAACCCAA
JMFS013A07+ TAAACCCAA
                      ____________________________________________________________
consensus CCTGAGCAGCAGGGGCCCATTCCTGATAGACAATGCAGCCTTCTTCTTTGTTAAACCCAA
 
. : . : . : . : . : . :
JMFS078D12+ ATTTCAAATAACCTAAAGCAAATTCCTCAAGACCCCCTTCATAATTTTCAAAGAGCTTTT
JMFS146F01+ ATTTCAAATAACCTAAAGCAAATTCCTCAAGACCCCCTTCATAATTTTCAAAGAGCTTTT
JMFS048D07+ ATTTCTAATATCTAATAGTAATTTCCTCAAGACCCCCCTCATAATTTCTAAAGAGCTTTT
JMFF019H03+ ATTTCAAATAACCTAAAGCAAATTCCTCAAGACCCCCTTCATAATTTTCAAAGAGCTTTT
JMFS043F06+ ATTTCAAATAACCTAAAGCAAATTCCTCAAGACCCCCTTCATAATTTTCAAAGAGCTTTT
JMFS013A07+ ATTTCAAATAACCTAAAGCAAATTCCTCAAGACCCCCTTCATAATTTTCAAAGAGCTTTT
                      ____________________________________________________________
consensus ATTTCAAATAACCTAAAGCAAATTCCTCAAGACCCCCTTCATAATTTTCAAAGAGCTTTT
 
. : . : . : . : . : . :
JMFS078D12+ TCTGATCCAAATATCTCTTCATTCTATATCTGAAGTGATCTTTATACGGTTCCAATCCTT
JMFS146F01+ TCTGATCCAAATATCTCTTCATTCTATATCTGAAGTGATCTTTATACGGTTCCAATCCTT
JMFS048D07+ TGTGATCCAAATATCTCTTCATTCTATATTTGAAGTGATCTTTATACTGTTCCAATCCTT
JMFF019H03+ TCTGATCCAAATATCTCTTCATTCTATATCTGAAGTGATCTTTATACGGTTCCAATCCTT
JMFS043F06+ TCTGATCCAAATATCTCTTCATTCTATATCTGAAGTGATCTTTATACGGTTCCAATCCTT
JMFS013A07+ TTTGATCCAAATATCTCTTCATTCTATATCTGAAGTGATCTTTATACGGTTCCAATCCTT
                      ____________________________________________________________
consensus TCTGATCCAAATATCTCTTCATTCTATATCTGAAGTGATCTTTATACGGTTCCAATCCTT
 
. : . : . : . : . : . :
JMFS078D12+ GGTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
JMFS146F01+ GGTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
JMFS048D07+ GGTTTAGGCCAAGAAGGTGGATATTCTCAATTTCTTTCTCTACANCCGCCTTTGTTGAAC
JMFF019H03+ GGTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
JMFS043F06+ GGTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
JMSF011L01+ GTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
JMFS013A07+ GGTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
                      ____________________________________________________________
consensus GGTCTAGGCCAAGAAGGTGGATATTTTCAATTTCTTTCTCTACATCCGCCATTGTTGAAC
 
. : . : . : . : . : . :
JMFS078D12+ TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
JMFS146F01+ TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
JMFS048D07+ TGTCATCAGTCTATACAGATGAAATANTTGAACTGTGCTCCCCCCATCTGTCATTCCTAA
JMFF019H03+ TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
JMFS043F06+ TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
JMSF011L01+ TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
JMFS013A07+ TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
                      ____________________________________________________________
consensus TGTCATCAGTCAAGACAGATGAAATATTTGAACTGTGCTCCCTCCATCTGTCATTCCTAA
 
. : . : . : . : . : . :
JMFS078D12+ GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
JMFS146F01+ GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
JMFS048D07+ GCCTTGANGCTGTAATAGAAAAAACATCCCAGGAGAGC-NTTGAGATTCAAAGATGGCTC
JMFF019H03+ GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
JMFS043F06+ GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
JMSF011L01+ GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
JMFS013A07+ GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
                      ____________________________________________________________
consensus GCCTTGATGCTGTAATAGAAAAAACATCCCAGGAGAGCTTTTGAGATTCAAAGATGGCAC
 
. : . : . : . : . : . :
JMFS078D12+ CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
JMFS146F01+ CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
JMFS048D07+ CAGGAGTGCATGGTGAAGCAAAAGATCTCTTACTTCTAGGAGCCCGCAAGAGANNNNTAG
JMFF019H03+ CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
JMFS043F06+ CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
JMSF011L01+ CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
JMSF018D09+ TAGGAGCCCGCAAGAGATTTTTAG
JMFS013A07+ CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
                      ____________________________________________________________
consensus CAGTAGTGCATGGTGAAGCAAAAGATCTCTTATTTCTAGGAGCCCGCAAGAGATTTTTAG
 
. : . : . : . : . : . :
JMFS078D12+ TCGGAATGG
JMFS146F01+ TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
JMFS048D07+ TCGGAACGGGTATGAAATATCCCACGAGAAGGTGAGGATAGGAGGCCGCAAGAAGT
JMFF019H03+ TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
JMFS043F06+ TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
JMSF011L01+ TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
JMSF018D09+ TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
JMFS013A07+ TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
                      ____________________________________________________________
consensus TCGGAATGGGTATGAAAGA-CCCACGAGAAGGTGACGATAGGAGGCCGCAAGAAGTTTGC
 
. : . : . : . : . : . :
JMFS146F01+ ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACA
JMFF019H03+ ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACAGTCTTCTGAGCTCACC
JMFS043F06+ ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACAGTCTTCTGAGCTCACCGAG
JMSF011L01+ ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACAGTCTTCTGAGCTCACCGAG
JMSF018D09+ ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACAGTCTTCTGAGCTCACCGAG
JMFS013A07+ ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACAGTCTTCTGAGCTCACCGAG
                      ____________________________________________________________
consensus ATAATATTTGTCGCAATCTGAGCGTATGCAGCAGAATCACAGTCTTCTGAGCTCACCGAG
 
. : . : . : . : . : . :
JMFS043F06+ CAGCAGAGAAGCGAAATGAATTGAATAAATTATGGACATGCGAGAGGAGTCTTGATGAAT
JMSF011L01+ CAGCAGAGAAGCGAAATGAATTGAATAAATTATGGACATGCGAGAGGAGTCTTGATGAAT
JMSF018D09+ CAGCAGAGAAGCGAAATGAATTGAATAAATTATGGACATGCGAGAGGAGTCTTGATGAAT
JMFS013A07+ CAGCAGAGAAGCGAAATGAATTGAATAAATTATGGACATGCGAGAGGAGTCTTGATGAAT
                      ____________________________________________________________
consensus CAGCAGAGAAGCGAAATGAATTGAATAAATTATGGACATGCGAGAGGAGTCTTGATGAAT
 
. : . : . : . : . : . :
JMFS043F06+ GTGA
JMSF011L01+ GTGACACCTTCATC
JMSF018D09+ GTGACACCTTCATC
JMFS013A07+ GTGACACCTTCATCACTGTACGAAGTAGTATAGAATAGAATAGAATACAAAGCGAAGAAA
                      ____________________________________________________________
consensus GTGACACCTTCATCACTGTACGAAGTAGTATAGAATAGAATAGAATACAAAGCGAAGAAA