Previous Contig 002927:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002C24Sequence566002927 (5)gb:AF530589_18090874e-35Petunia integrifolia subsp. inflata S3 self-incompatibility locus-linked pollen 223002490 (4)
JMFF018C05Sequence597002927 (5)gb:AF530589_18090871e-36Petunia integrifolia subsp. inflata S3 self-incompatibility locus-linked pollen 296002490 (4)
JMFS011F01Sequence624002927 (5)gb:AF530589_18090871e-36Petunia integrifolia subsp. inflata S3 self-incompatibility locus-linked pollen
JMFS074A07Sequence627002927 (5)gb:AF530589_18090872e-41Petunia integrifolia subsp. inflata S3 self-incompatibility locus-linked pollen
JMFS080G12Sequence614002927 (5)gb:AF530589_18090875e-37Petunia integrifolia subsp. inflata S3 self-incompatibility locus-linked pollen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS074A07+ AAGCCAGTTCAAC
                      ____________________________________________________________
consensus AAGCCAGTTCAAC
 
. : . : . : . : . : . :
JMFS074A07+ CATAACTTTGCTGTCAGAATAACTGATCCATCTTCTACAACATGTATGACTTTCAGAATC
JMFS080G12+ ACTGATCCATCTTCTACAACATGTATGACTTTCAGAATC
JMFF018C05+ GTATGACTTTCAGAATC
JMFS011F01+ GTATGACTTTCAGAATC
                      ____________________________________________________________
consensus CATAACTTTGCTGTCAGAATAACTGATCCATCTTCTACAACATGTATGACTTTCAGAATC
 
. : . : . : . : . : . :
JMFS074A07+ TCACTATTACTTTCCCCACTAGAGACATCAACTTCATTATACTCCGTCTCATTCTGGAAC
JMFS080G12+ TCACTATTACTTTCCCCACTAGAGACATCAACTTCATTATACTCCGTCTCATTCTGGAAC
JMFF018C05+ TCACTATTACTTTCCCCACTAGAGACATCAACTTCATTATACTCCGTCTCATTCTGGAAC
JMFF002C24+ CCCACTAGAGACATCAACTTCATTATACTCCGTCTCATTCTGGAAC
JMFS011F01+ TCACTATTACTTTCCCCACTAGAGACATCAACTTCATTATACTCCGTCTCATTCTGGAAC
                      ____________________________________________________________
consensus TCACTATTACTTTCCCCACTAGAGACATCAACTTCATTATACTCCGTCTCATTCTGGAAC
 
. : . : . : . : . : . :
JMFS074A07+ CACAAGCCAGCACTGGTAATCTTGATTTGAATAATTTGCACATCTGAGATGTCCACTTTT
JMFS080G12+ CACAAGCCAGCACTGGTAATCTTGATTTGAATAATTTGCACATCTGAGATGTCCACTTTT
JMFF018C05+ CACAAGCCAGCACTGGTAATCTTGATTTGAATAATTTGCACATCTGAGATGTCCACTTTT
JMFF002C24+ CACAAGCCAGCACTGGTAATCTTGATTTGAATAATTTGCACATCTGAGATGTCCACTTTT
JMFS011F01+ CACAAGCCAGCACTGGTAATCTTGATTTGAATAATTTGCACATCTGAGATGTCCACTTTT
                      ____________________________________________________________
consensus CACAAGCCAGCACTGGTAATCTTGATTTGAATAATTTGCACATCTGAGATGTCCACTTTT
 
. : . : . : . : . : . :
JMFS074A07+ GACAACTCGCTCGAACAGCCAGGCTGCTGAACATAGTTGGCGTGCATAACAACGAGAATA
JMFS080G12+ GACAACTCGCTCGAACAGCCAGGCTGCTGAACATAGTTGGCGTGCATAACAACGAGAATA
JMFF018C05+ GACAACTCGCTCGAACAGCCAGGCTGCTGAACATAGTTGGCGTGCATAACAACGAGAATA
JMFF002C24+ GACAACTCGCTCGAACAGCCAGGCTGCTGAACATAGTTGGCGTGCATAACAACGAGAATA
JMFS011F01+ GACAACTCGCTCGAACAGCCAGGCTGCTGAACATAGTTGGCGTGCATAACAACGAGAATA
                      ____________________________________________________________
consensus GACAACTCGCTCGAACAGCCAGGCTGCTGAACATAGTTGGCGTGCATAACAACGAGAATA
 
. : . : . : . : . : . :
JMFS074A07+ CAGAAGAGAGTGACGGCGACGAAGAGCAAGAAATATTCGAGTGTAGCTCGAATCCTCGGA
JMFS080G12+ CAGAAGAGAGTGACGGCGACGAAGAGCAAGAAATATTCGAGTGTAGCTCGAATCCTCGGA
JMFF018C05+ CAGAAGAGAGTGACGGCGACGAAGAGCAAGAAATATTCGAGTGTAGCTCGAATCCTCGGA
JMFF002C24+ CAGAAGAGAGTGACGGCGACGAAGAGCAAGAAATATTCGAGTGTAGCTCGAATCCTCGGA
JMFS011F01+ CAGAAGAGAGTGACGGCGACGAAGAGCAAGAAATATTCGAGTGTAGCTCGAATCCTCGGA
                      ____________________________________________________________
consensus CAGAAGAGAGTGACGGCGACGAAGAGCAAGAAATATTCGAGTGTAGCTCGAATCCTCGGA
 
. : . : . : . : . : . :
JMFS074A07+ CTCAGCATCTGAGAGAACCGTTCCTGTACGCGTATAAACGTCTGTTCCGGATCCATCGAT
JMFS080G12+ CTCAGCATCTGAGAGAACCGTTCCTGTACGCGTATAAACGTCTGTTCCGGATCCATCGAT
JMFF018C05+ CTCAGCATCTGAGAGAACCGTTCCTGTACGCGTATAAACGTCTGTTCCGGATCCATCGAT
JMFF002C24+ CTCAGCATCTGAGAGAACCGTTCCTGTACGCGTATAAACGTCTGTTCCGGATCCATCGAT
JMFS011F01+ CTCAGCATCTGAGAGAACCGTTCCTGTACGCGTATAAACGTCTGTTCCGGATCCATCGAT
                      ____________________________________________________________
consensus CTCAGCATCTGAGAGAACCGTTCCTGTACGCGTATAAACGTCTGTTCCGGATCCATCGAT
 
. : . : . : . : . : . :
JMFS074A07+ TATCTACGCCTATATACACACACATATACATGCATACATACAAGTGTGAAGGTTTTGTAT
JMFS080G12+ TATCTACGCCTATATACACACACATATACATGCATACATACAAGTGTGAAGGTTTTGTAT
JMFF018C05+ TATCTACGCCTATATACACACACATATACATGCATACATACAAGTGTGAAGGTTTTGTAT
JMFF002C24+ TATCTACGCCTATATACACACACATATACATGCATACATACAAGTGTGAAGGTTTTGTAT
JMFS011F01+ TATCTACGCCTATATACACACACATATACATGCATACATACAAGTGTGAAGGTTTTGTAT
                      ____________________________________________________________
consensus TATCTACGCCTATATACACACACATATACATGCATACATACAAGTGTGAAGGTTTTGTAT
 
. : . : . : . : . : . :
JMFS074A07+ GTATCTACGAGTATCAACACAATCGTATACGCTCAAATTCAATTGCTACAAATTTATGAT
JMFS080G12+ GTATCTACGAGTATCAACACAATCGTATACGCTCAAATTCAATTGCTACAAATTTATGAT
JMFF018C05+ GTATCTACGAGTATCAACACAATCGTATACGCTCAAATTCAATTGCTACAAATTTATGAT
JMFF002C24+ GTATCTACGAGTATCAACACAATCGTATACGCTCAAATTCAATTGCTACAAATTTATGAT
JMFS011F01+ GTATCTACGAGTATCAACACAATCGTATACGCTCAAATTCAATTGCTACAAATTTATGAT
                      ____________________________________________________________
consensus GTATCTACGAGTATCAACACAATCGTATACGCTCAAATTCAATTGCTACAAATTTATGAT
 
. : . : . : . : . : . :
JMFS074A07+ GCAAACAACACCGTGTAATTAATCTCTGTATCTTCAGAGGACACTCAATAGAATCATAGG
JMFS080G12+ GCAAACAACACCGTGTAATTAATCTCTGTATCTTCAGAGGACACTCAATAGAATCATAGG
JMFF018C05+ GCAAACAACACCGTGTAATTAATCTCTGTATCTTCAGAGGACACTCAATAGAATCATAGG
JMFF002C24+ GCAAACAACACCGTGTAATTAATCTCTGTATCTTCAGAGGACACTCAATAGAATCATAGG
JMFS011F01+ GCAAACAACACCGTGTAATTAATCTCTGTATCTTCAGAGGACACTCAATAGAATCATAGG
                      ____________________________________________________________
consensus GCAAACAACACCGTGTAATTAATCTCTGTATCTTCAGAGGACACTCAATAGAATCATAGG
 
. : . : . : . : . : . :
JMFS074A07+ TTCGCCGATTTTGCTGATCGGCCAAGTTTTAGGATTAGTTTTGTGCTGGAATCGAAGCTG
JMFS080G12+ TTCGCCGATTTTGCTGATCGGCCAAGTTTTAGGATTAGTTTTGTGCTGGAATCGAAGCTG
JMFF018C05+ TTCGCCGATTTTGCTGATCGGCCAAGTTTTAGGATTAGTTTTGTGCTGGAATCGAAGCTG
JMFF002C24+ TTCGCCGATTTTGCTGATCGGCCAAGTTTTAGGATTAGTTTTGTGCTGGAATCGAAGCTG
JMFS011F01+ TTCGCCGATTTTGCTGATCGGCCAAGTTTTAGGATTAGTTTTGTGCTGGAATCGAAGCTG
                      ____________________________________________________________
consensus TTCGCCGATTTTGCTGATCGGCCAAGTTTTAGGATTAGTTTTGTGCTGGAATCGAAGCTG
 
. : . : . : . : . : . :
JMFS074A07+ AGAGTTTCTTCCCC
JMFS080G12+ AGAGTTTCTTCCCCGAAGATGCCTGCACTTGGGGA
JMFF018C05+ AGAGTTTCTTCCCCGAAGATGCCTGCACTTGGGGA
JMFF002C24+ AGAGTTTCTTCCCCGAAGATGCCTGCACTTGGGGA
JMFS011F01+ AGAGTTTCTTCCCCGAAGATGCCTGCACTTGGGGAGCATCGTCAAAGTTCAAAGATGGAA
                      ____________________________________________________________
consensus AGAGTTTCTTCCCCGAAGATGCCTGCACTTGGGGAGCATCGTCAAAGTTCAAAGATGGAA