Previous Contig 002925:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011E11Sequence602002925 (6)
JMFS057C05Sequence637002925 (6)gb:AB061795_15220882e-05Bruguiera gymnorhiza bg55 mRNA, complete cds.
JMFS094C02Sequence626002925 (6)gb:AB061795_15220883e-25Bruguiera gymnorhiza bg55 mRNA, complete cds.
JMFS108A08Sequence626002925 (6)gb:AB061795_15220885e-35Bruguiera gymnorhiza bg55 mRNA, complete cds.
JMFS141C12Sequence626002925 (6)gb:AB061795_15220882e-05Bruguiera gymnorhiza bg55 mRNA, complete cds.
JMSF026M03Sequence672002925 (6)gb:AB061795_15220889e-22Bruguiera gymnorhiza bg55 mRNA, complete cds.697014014 (2)gb:AB061795_15220883e-16Bruguiera gymnorhiza bg55 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS108A08+ AAGATCAGCAACTAAC
                      ____________________________________________________________
consensus AAGATCAGCAACTAAC
 
. : . : . : . : . : . :
JMFS108A08+ TGAGAAATCTCTGCAGCCAGCATAACGGGGACCATATGTTGCATCTCGCCTAAGCTTCGC
JMFS094C02+ AAGCTTCGC
                      ____________________________________________________________
consensus TGAGAAATCTCTGCAGCCAGCATAACGGGGACCATATGTTGCATCTCGCCTAAGCTTCGC
 
. : . : . : . : . : . :
JMFS108A08+ TCCAGTAACTTCGTTGACTTTTTGCATC-TTGCGAGTATAACATCACCCGTTAGAGCCAA
JMFS094C02+ TCCAGTAACTTCGTTGAC-TTTTGCATCNTTGCGAGTATAACATCACCCGTTAGAGCCAA
JMSF026M03+ CGAGTATAACATCACCCGTTAGAGCCAA
                      ____________________________________________________________
consensus TCCAGTAACTTCGTTGACTTTTTGCATCNTTGCGAGTATAACATCACCCGTTAGAGCCAA
 
. : . : . : . : . : . :
JMFS108A08+ ATAGATCTTACTGGATTCACTGCATTGCTGAAGTATTAACTTGGCCTTGTCGATCGCTTG
JMFS094C02+ ATAGATCTTACTGGATTCACTGCATTGCTGAAGTATTAACTTGGCCTTGTCGATCGCTTG
JMSF026M03+ ATAGATCTTACTGGATTCACTGCATTGCTGAAGTATTAACTTGGCCTTGTCGATCGCTTG
                      ____________________________________________________________
consensus ATAGATCTTACTGGATTCACTGCATTGCTGAAGTATTAACTTGGCCTTGTCGATCGCTTG
 
. : . : . : . : . : . :
JMFS108A08+ GTTCAATAGGCAAAGTGCCTCCAATCCCGATGTGCATCGAGGTCGAGATGCTTCTATTTC
JMFS094C02+ GTTCAATAGGCAAAGTGCCTCCAATCCCGATGTGCATCGAGGTCGAGATGCTTCTATTTC
JMSF026M03+ GTTCAATAGGCAAAGTGCCTCCAATCCCGATGTGCATCGAGGTCGAGATGCTTCTATTTC
JMFS141C12+ GTGCATCGAGGTCGAGATGCTTCTATTTC
JMFS057C05+ GCATCGAGGTCGAGATGCTTCTATTTC
                      ____________________________________________________________
consensus GTTCAATAGGCAAAGTGCCTCCAATCCCGATGTGCATCGAGGTCGAGATGCTTCTATTTC
 
. : . : . : . : . : . :
JMFS108A08+ CGGAAGTATTTCCAAGGCTCGAGTAACAAACTTGATCAATTCCGAACACATTAGAAGATG
JMFS094C02+ CGGAAGTATTTCCAAGGCTCGAGTAACAAACTTGATCAATTCCGAACACATTAGAAGATG
JMSF026M03+ CGGAAGTATTTCCAAGGCTCGAGTAACAAACTTGATCAATTCCGAACACATTAGAAGATG
JMFS141C12+ CGGAAGTATTTCCAAGGCTCGAGTAACAAACTTGATCAATTCCGAACACATTAGAAGATG
JMFS057C05+ CGGAAGTATTTCCAAGGCTCGAGTAACAAACTTGATCAATTCCGAACACATTAGAAGATG
                      ____________________________________________________________
consensus CGGAAGTATTTCCAAGGCTCGAGTAACAAACTTGATCAATTCCGAACACATTAGAAGATG
 
. : . : . : . : . : . :
JMFS108A08+ CACCTTAATAGACTGAGGAGACGGGAGTGCTTCTGCACCTTCAGTGGGATCACTCCCCAT
JMFS094C02+ CACCTTAATAGACTGAGGAGACGGGAGTGCTTCTGCACCTTCAGTGGGATCACTCCCCAT
JMSF026M03+ CACCTTAATAGACTGAGGAGACGGGAGTGCTTCTGCACCTTCAGTGGGATCACTCCCCAT
JMFS141C12+ CACCTTAATAGACTGAGGAGACGGGAGTGCTTCTGCACCTTCAGTGGGATCACTCCCCAT
JMFS057C05+ CACCTTAATAGACTGAGGAGACGGGAGTGCTTCTGCACCTTCAGTGGGATCACTCCCCAT
JMFS011E11+ AT
                      ____________________________________________________________
consensus CACCTTAATAGACTGAGGAGACGGGAGTGCTTCTGCACCTTCAGTGGGATCACTCCCCAT
 
. : . : . : . : . : . :
JMFS108A08+ AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
JMFS094C02+ AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
JMSF026M03+ AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
JMFS141C12+ AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
JMFS057C05+ AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
JMFS011E11+ AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
                      ____________________________________________________________
consensus AAAGAAGGATTATCAGTGACACACAGATGTATGGTTAAACTGCAAACAGAAGAATCAGAA
 
. : . : . : . : . : . :
JMFS108A08+ AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
JMFS094C02+ AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
JMSF026M03+ AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
JMFS141C12+ AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
JMFS057C05+ AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
JMFS011E11+ AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
                      ____________________________________________________________
consensus AGATGATGGATTCCAGGCAAAATTTCAAACTTGAAGCACTAAAACCTAGTTCAAACTCAA
 
. : . : . : . : . : . :
JMFS108A08+ GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
JMFS094C02+ GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
JMSF026M03+ GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
JMFS141C12+ GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
JMFS057C05+ GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
JMFS011E11+ GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
                      ____________________________________________________________
consensus GAAAAGCTGCAATCTTTCTTAACTTGTTGCCCAGATAAGAAAACCCCACTCTTTTAAGAT
 
. : . : . : . : . : . :
JMFS108A08+ GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
JMFS094C02+ GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
JMSF026M03+ GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
JMFS141C12+ GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
JMFS057C05+ GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
JMFS011E11+ GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
                      ____________________________________________________________
consensus GCCCAAAAATGAAAAATCCCACTTGTCTTCCCAAGTGGATAAGCCTAGAGATTCTGGGTC
 
. : . : . : . : . : . :
JMFS108A08+ ACCACAACCGA
JMFS094C02+ ACCACAACCGACGGTGCCATGTAAGAACCCACGAACTAGGAACAGCACATGAATTCACCA
JMSF026M03+ ACCACAACCGACGGTGCCATGTAAGAACCCACGAACTAGGAACAGCACATGAATTCACCA
JMFS141C12+ ACCACAACCGACGGTGCCATGTAAGAACCCACGAACTAGGAACAGCACATGAATTCACCA
JMFS057C05+ ACCACAACCGACGGTGCCATGTAAGAACCCACGAACTAGGAACAGCACATGAATTCACCA
JMFS011E11+ ACCACAACCGACGGTGCCATGTAAGAACCCACGAACTAGGAACAGCACATGAATTCACCA
                      ____________________________________________________________
consensus ACCACAACCGACGGTGCCATGTAAGAACCCACGAACTAGGAACAGCACATGAATTCACCA
 
. : . : . : . : . : . :
JMFS094C02+ TTAAAGCAACCACCTAAC
JMSF026M03+ TTAAAGCAACCACCTAACTCACATAGGAAAATCCAAAAGAATACCATTCAATTTCAAGGC
JMFS141C12+ TTAAAGCAACCACCTAACTCACATAGGAAAATCCAAAAGAATACCATTCAATTTCAAGGC
JMFS057C05+ TTAAAGCAACCACCTAACTCACATAGGAAAATCCAAAAGAATACCATTCAATTTCAAGGC
JMFS011E11+ TTAAAGCAACCACCTAACTCACATAGGAAAATCCAAAAGAATACCATTCAATTTCAAGGC
                      ____________________________________________________________
consensus TTAAAGCAACCACCTAACTCACATAGGAAAATCCAAAAGAATACCATTCAATTTCAAGGC
 
. : . : . : . : . : . :
JMSF026M03+ CCCAACTACACCTCAGAGGCACAGAGGAGAGAGAGAGACCTG
JMFS141C12+ CCCAACTACACCTCAGAGGCACAGAGGAGAGAGAGAGACCTGTGAAGTTGAAGTATAGTA
JMFS057C05+ CCCAACTACACCTCAGAGGCACAGAGGAGAGAGAGAGACCTGTGAAGTTGAAGTATAGTA
JMFS011E11+ CCCAACTACACCTCAGAGGCACAGAGGAGAGAGAGAGACCTGTGAAGTTGAAGTATAGTA
                      ____________________________________________________________
consensus CCCAACTACACCTCAGAGGCACAGAGGAGAGAGAGAGACCTGTGAAGTTGAAGTATAGTA
 
. : . : . : . : . : . :
JMFS141C12+ GACTTTACGTAAAATAGCGGGTAACCTGCTAACCACTACTACGATACTACCCAGGGA
JMFS057C05+ GACTTTACGTAAAATAGCGGGTAACCTGCTAACCACTACTACGATACTACCCAGGGATAG
JMFS011E11+ GACTTTACGTAAAATAGCGGGTAACCTGCTAACCACTACTACGATACTACCCAGGGATAG
                      ____________________________________________________________
consensus GACTTTACGTAAAATAGCGGGTAACCTGCTAACCACTACTACGATACTACCCAGGGATAG
 
. : . : . : . : . : . :
JMFS057C05+ AAGATTGGAA
JMFS011E11+ AAGATTGGAAGTACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXATGGAA
                      ____________________________________________________________
consensus AAGATTGGAAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAA
 
. : . : . : . : . : . :
JMFS011E11+ CCGAAATAAAGAAGAAAAGGGTATATAGGGAGGATTGAGGAAGCATCCAAAAGCGCAGAC
                      ____________________________________________________________
consensus CCGAAATAAAGAAGAAAAGGGTATATAGGGAGGATTGAGGAAGCATCCAAAAGCGCAGAC