Previous Contig 002924:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011E07Sequence627002924 (3)gb:AY363616_16027546e-47Malus baccata putative TIR-NBS type R protein 4 (R4) mRNA, complete cds.
JMFS124C09Sequence561002924 (3)gb:PDE416708_16995832e-42Populus deltoides MER locus, genomic DNA, cultivar S9-2.
JMSF016L21Sequence238002924 (3)gb:POP490334_17009870.024Populus balsamifera subsp. trichocarpa mRNA for TIR-NBS disease resistance prote752022736

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS011E07+ CATGATTTTCAAATCCCATCCTGACAA
                      ____________________________________________________________
consensus CATGATTTTCAAATCCCATCCTGACAA
 
. : . : . : . : . : . :
JMFS124C09+ AGTAGTGAGTGCAGCTTTCCACTCATCAACTCTTTGATCCCCAAATCGTTC
JMFS011E07+ ATTAGCAACAGTAGTGAGTGCAGCTTTCCACTCATCAACTCTTTGATCCCCAAATCGTTC
                      ____________________________________________________________
consensus ATTAGCAACAGTAGTGAGTGCAGCTTTCCACTCATCAACTCTTTGATCCCCAAATCGTTC
 
. : . : . : . : . : . :
JMFS124C09+ TAGATGTTGAATCAATGAATCACCAAATTCTCCTGTTTGTTTGCGAACTTCTGAAGGATC
JMFS011E07+ TAGATGTTGAATCAATGAATCACCAAATTCTCCTGTTTGTTTGCGAACTTCTGAAGGATC
                      ____________________________________________________________
consensus TAGATGTTGAATCAATGAATCACCAAATTCTCCTGTTTGTTTGCGAACTTCTGAAGGATC
 
. : . : . : . : . : . :
JMFS124C09+ AACATCATAGAATATTGGAAGAACCATTTGTCCTAAATTCTGTTTACATTCAACAATCTT
JMFS011E07+ AACATCATAGAATATTGGAAGAACCATTTGTCCTAAATTCTGTTTACATTCAACAATCTT
                      ____________________________________________________________
consensus AACATCATAGAATATTGGAAGAACCATTTGTCCTAAATTCTGTTTACATTCAACAATCTT
 
. : . : . : . : . : . :
JMFS124C09+ CACCAGTTCATCAAGACACCATCTAGATCGAGCATAAGTTTTAGAGAATACGATAATTGA
JMFS011E07+ CACCAGTTCATCAAGACACCATCTAGATCGAGCATAAGTTTTAGAGAATACGATAATTGA
                      ____________________________________________________________
consensus CACCAGTTCATCAAGACACCATCTAGATCGAGCATAAGTTTTAGAGAATACGATAATTGA
 
. : . : . : . : . : . :
JMFS124C09+ TATCTTGGACCCTTCGATAGCCTTCAATAGCTCATCAGAGATGCTCTCGCCTTTCCGGAT
JMFS011E07+ TATCTTGGACCCTTCGATAGCCTTCAATAGCTCATCAGAGATGCTCTCGCCTTTCCGGAT
                      ____________________________________________________________
consensus TATCTTGGACCCTTCGATAGCCTTCAATAGCTCATCAGAGATGCTCTCGCCTTTCCGGAT
 
. : . : . : . : . : . :
JMFS124C09+ CCCTTCATCATCTCGAAAGGTATTAACTCCAGCTTGACACAAACTTAAATAAAGATGATC
JMSF016L21+ ACACAAACTTAAATAAAGATGATC
JMFS011E07+ CCCTTCATCATCTCGAAAGGTATTAACTCCAGCTTGACACAAACTTAAATAAAGATGATC
                      ____________________________________________________________
consensus CCCTTCATCATCTCGAAAGGTATTAACTCCAGCTTGACACAAACTTAAATAAAGATGATC
 
. : . : . : . : . : . :
JMFS124C09+ AGTAAAGGATTTTCGTGTCTCTCCTCTAAAACTCAAGAAAACATGGTACAACGAAGCAGC
JMSF016L21+ AGTAAAGGATTTTCGTGTCTCTCCTCTAAAACTCAAGAAAACATGGTACAACGAAGCAGC
JMFS011E07+ AGTAAAGGATTTTCGTGTCTCTCCTCTAAAACTCAAGAAAACATGGTACAACGAAGCAGC
                      ____________________________________________________________
consensus AGTAAAGGATTTTCGTGTCTCTCCTCTAAAACTCAAGAAAACATGGTACAACGAAGCAGC
 
. : . : . : . : . : . :
JMFS124C09+ AGATGATGATGATGATGATGAAGAAGAAGAAGCCATAGTTGATATTGATCTGTGAATACA
JMSF016L21+ AGATGATGATGATGATGATGAAGAAGAAGAAGCCATAGTTGATATTGATCTGTGAATACA
JMFS011E07+ AGATGATGATGATGATGATGAAGAAGAAGAAGCCATAGTTGATATTGATCTGTGAATACA
                      ____________________________________________________________
consensus AGATGATGATGATGATGATGAAGAAGAAGAAGCCATAGTTGATATTGATCTGTGAATACA
 
. : . : . : . : . : . :
JMFS124C09+ CTACTTTCTGTTTTGATTTGCTAGAAGAGATTGGGTGTAGTAGACAAGCGGTGACTTAGA
JMSF016L21+ CTACTTTCTGTTTTGATTTGCTAGAAGAGATTGGGTGTAGTAGACAAGCGGCGACTTAGA
JMFS011E07+ CTACTTTCTGTTTTGATTTGCTAGAAGAGATTGGGTGTAGTAGACAAGCGGTGACTTAGA
                      ____________________________________________________________
consensus CTACTTTCTGTTTTGATTTGCTAGAAGAGATTGGGTGTAGTAGACAAGCGGTGACTTAGA
 
. : . : . : . : . : . :
JMFS124C09+ CATTACAAAGTAAGATAGGAAACTTCATTC
JMSF016L21+ CATTACAAAGTAAGATAGGAAACTTCATTC
JMFS011E07+ CATTACAAAGTAAGATAGGAAACTTCATTCTTTGGAATGCGAAACTCAAAGGAAATTTCT
                      ____________________________________________________________
consensus CATTACAAAGTAAGATAGGAAACTTCATTCTTTGGAATGCGAAACTCAAAGGAAATTTCT