Previous Contig 002922:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024F14Sequence463002922 (9)gb:AC005724_15329535e-33Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.531009455 (7)pir|T03793|T037931e-12calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFF026J03Sequence575002922 (9)gb:AC005724_15329532e-67Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.724009455 (7)pir|T03793|T037933e-39calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFF032B02Sequence524002922 (9)gb:AC005724_15329539e-59Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.719009455 (7)pir|T03793|T037936e-39calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFS011D10Sequence622002922 (9)gb:AC005724_15329531e-59Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.
JMFS079G08Sequence627002922 (9)gb:AC005724_15329531e-77Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.
JMFS112D02Sequence627002922 (9)gb:AC005724_15329531e-60Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.
JMFS138E07Sequence620002922 (9)gb:AC005724_15329534e-61Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.
JMSF022H18Sequence652002922 (9)gb:AC005724_15329536e-82Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.744009455 (7)pir|T03793|T037932e-42calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMSF041I17Sequence825002922 (9)gb:AC005724_15329537e-93Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.632009455 (7)pir|T03793|T037933e-28calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I17+ CCAACTAGAATTATCTGTAAATATCAG
                      ____________________________________________________________
consensus CCAACTAGAATTATCTGTAAATATCAG
 
. : . : . : . : . : . :
JMSF041I17+ CTCTCCAAGAGTTCCAACACCTTCTTTTAGTGTTACTTGCAAATCACCAGTCAACAATGG
JMFS079G08+ ATCACCAGTCAACAATGG
JMSF022H18+ TTAGTGTTACTTGCAAATCACCAGTCAACAATGG
                      ____________________________________________________________
consensus CTCTCCAAGAGTTCCAACACCTTCTTTTAGTGTTACTTGCAAATCACCAGTCAACAATGG
 
. : . : . : . : . : . :
JMSF041I17+ TCTCTTGCCTTCTCGTTCTTTTACAACATGACTTTCAAATTCTTCCTGGGTCCAATCATC
JMFS079G08+ TCTCTGCCTTTCTCGTTCTTNTACAACATGACTTTCAAATTCTTCCTGGGTCCAATCATC
JMSF022H18+ TCTCTTGCCTTCTCGTTCTTTTACAACATGACTTTCAAATTCTTCCTGGGTCCAATCATC
JMFF026J03+ CAATCATC
                      ____________________________________________________________
consensus TCTCTTGCCTTCTCGTTCTTTTACAACATGACTTTCAAATTCTTCCTGGGTCCAATCATC
 
. : . : . : . : . : . :
JMSF041I17+ ATCATCTTCATTATTAAAATCACCTTCTAGCACAACAACATCCAGCTTCATACATGACTC
JMFS079G08+ ATCATCTTCATTATTAAAATCACCTTCTAGCACAACAACATCCAGCTTCATACATGACTC
JMSF022H18+ ATCATCTTCATTATTAAAATCACCTTCTAGCACAACAACATCCAGCTTCATACATGACTC
JMFF032B02+ AGCTTCATACATGACTC
JMFF026J03+ ATCATCTTCATTATTAAAATCACCTTCTAGCACAACAACATCCAGCTTCATACATGACTC
JMFS138E07+ AGCACAACAACATCCAGCTTCATACATGACTC
JMFS112D02+ CAACAACATCCAGCTTCATACATGACTC
JMFS011D10+ CATCCAGCTTCATACATGACTC
                      ____________________________________________________________
consensus ATCATCTTCATTATTAAAATCACCTTCTAGCACAACAACATCCAGCTTCATACATGACTC
 
. : . : . : . : . : . :
JMSF041I17+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMFS079G08+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMSF022H18+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMFF032B02+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMFF026J03+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMFS138E07+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMFS112D02+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
JMFS011D10+ AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
                      ____________________________________________________________
consensus AGGTCCAGTTGTTACAACATGTCCACTATTAGAATCAATTAGGACAACATGGATGGCAGC
 
. : . : . : . : . : . :
JMSF041I17+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMFS079G08+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMSF022H18+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMFF032B02+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMFF026J03+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMFS138E07+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMFS112D02+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
JMFS011D10+ ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
                      ____________________________________________________________
consensus ACCCTGTTCCCCTTCAACTTTACCCCCAGTAAAGAGGGGCAAGGAAAGTCTGGATCTAAA
 
. : . : . : . : . : . :
JMSF041I17+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMFS079G08+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMSF022H18+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMFF032B02+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMFF024F14+ ATTCGCTTAGGCGATGACCTTGCAGC
JMFF026J03+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMFS138E07+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMFS112D02+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
JMFS011D10+ ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
                      ____________________________________________________________
consensus ATGAAGTTGCATGTTCCGTCCATCAGGCCCTTCAATTCGCTTAGGCGATGACCTTGCAGC
 
. : . : . : . : . : . :
JMSF041I17+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFS079G08+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMSF022H18+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFF032B02+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFF024F14+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFF026J03+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFS138E07+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFS112D02+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
JMFS011D10+ AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
                      ____________________________________________________________
consensus AATTCTTGCAGGGCCTAACTTTGCCAAAGCTCGTTCCACTTCTTCACTAACAACTCTGCG
 
. : . : . : . : . : . :
JMSF041I17+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFS079G08+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMSF022H18+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFF032B02+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFF024F14+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFF026J03+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFS138E07+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFS112D02+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
JMFS011D10+ AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
                      ____________________________________________________________
consensus AAGAATTGGTTCCAAGGAAGAGCACAGCTTTTGGAGACTATCCACCTTGAGAGCTTCCAC
 
. : . : . : . : . : . :
JMSF041I17+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFS079G08+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMSF022H18+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFF032B02+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFF024F14+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFF026J03+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFS138E07+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFS112D02+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
JMFS011D10+ AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
                      ____________________________________________________________
consensus AATAACACTAGCTAAAGCAGGTCGTTTGCGCTCCGGCTGCTGCTCCTCATCTCCTTCCAA
 
. : . : . : . : . : . :
JMSF041I17+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFS079G08+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMSF022H18+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFF032B02+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFF024F14+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFF026J03+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFS138E07+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFS112D02+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
JMFS011D10+ ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
                      ____________________________________________________________
consensus ACTCCTCTTTCCTCTCATTGAGTTGGTCCTTTCCATGTACCGAGTCTGCATTCTAATCCA
 
. : . : . : . : . : . :
JMSF041I17+ CCAAACAGAAGCCCTATCCACT
JMFS079G08+ CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
JMSF022H18+ CCAAACAGAAGCC-------CTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
JMFF032B02+ CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
JMFF024F14+ CCAAACAGAAGCCCTATCCACT
JMFF026J03+ CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
JMFS138E07+ CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
JMFS112D02+ CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
JMFS011D10+ CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
                      ____________________________________________________________
consensus CCAAACAGAAGCCCTATCCACTGATTGGTTGTTGACGTTTCCGTTGAGGTCTCCGAGGTT
 
. : . : . : . : . : . :
JMFS079G08+ TCCCTCTGT
JMSF022H18+ TCCCTCTGTGTCTCTCTCTCTCTC
JMFF032B02+ TCCCTCTGTGTCTCTCTCTCTCTC
JMFF026J03+ TCCCTCTGTGTCTCTCTCTCTCTCAAC
JMFS138E07+ TCCCTCTGTGTCTCTCTCTCTCTCAACAGCTCAGAGTAACGCTTCAGTGCTCTTATTGGG
JMFS112D02+ TCCCTCTGTGTCTCTCTCTCTCTCAACAGCTCAGAGTAACGCTTCAGTGCTCTTATTGGG
JMFS011D10+ TCCCTCTGTGTCTCTCTCTCTCTCAACAGCTCAGAGTAACGCTTCAGTGCTCTTATTGGG
                      ____________________________________________________________
consensus TCCCTCTGTGTCTCTCTCTCTCTCAACAGCTCAGAGTAACGCTTCAGTGCTCTTATTGGG
 
. : . : . : . : . : . :
JMFS138E07+ CGGCCCAGAGGGGTGGTGAACGCGCGTGGGGGTGGCGCGTGGGTTGCA
JMFS112D02+ CGGCCCAGAGGGGTGGTGAACGCGCGTGGGGGTGGCGCGTGGGTTGCAGCTAGTCTCGA
JMFS011D10+ CGGCCCAGAGGGGTGGTGAACGCGCGTGGGGGTGGCGCGTGGGTTGCAGCTAGTCTCGAC
                      ____________________________________________________________
consensus CGGCCCAGAGGGGTGGTGAACGCGCGTGGGGGTGGCGCGTGGGTTGCAGCTAGTCTCGAC