Previous Contig 002921:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011D07Sequence627002921 (2)gb:AB196790_15296992e-37Nicotiana tabacum NKT1 mRNA for potassium channel NKT1, complete cds.
JMFS084A06Sequence627002921 (2)gb:AB196790_15296993e-38Nicotiana tabacum NKT1 mRNA for potassium channel NKT1, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS084A06+ TGGGTCATCAATGAGAAGATAAGTAGTTT
JMFS011D07+ GGTCATCAATGAGAAGATAAGTAGTTT
                      ____________________________________________________________
consensus TGGGTCATCAATGAGAAGATAAGTAGTTT
 
. : . : . : . : . : . :
JMFS084A06+ TATCAAGGTAAGCAACAAAGAATGTCAACACAATATCTATAGCAAAAACTGCATTCACAA
JMFS011D07+ TATCAAGGTAAGCAACAAAGAATGTCAACACAATATCTATAGCAAAAACTGCATTCACAA
                      ____________________________________________________________
consensus TATCAAGGTAAGCAACAAAGAATGTCAACACAATATCTATAGCAAAAACTGCATTCACAA
 
. : . : . : . : . : . :
JMFS084A06+ CATTGTCACAGATAGCAAGAGGTCCATTTGGCGTTTCTAGGAACCCAAACTCAAAAGGAG
JMFS011D07+ CATTGTCACAGATAGCAAGAGGTCCATTTGGCGTTTCTAGGAACCCAAACTCAAAAGGAG
                      ____________________________________________________________
consensus CATTGTCACAGATAGCAAGAGGTCCATTTGGCGTTTCTAGGAACCCAAACTCAAAAGGAG
 
. : . : . : . : . : . :
JMFS084A06+ ATACCCATGCTGTGTAGAACACAAGTAGTACTAGAAATGTCTCCCAGTTCCTGTAATAGG
JMFS011D07+ ATACCCATGCTGTGTAGAACACAAGTAGTACTAGAAATGTCTCCCAGTTCCTGTAATAGG
                      ____________________________________________________________
consensus ATACCCATGCTGTGTAGAACACAAGTAGTACTAGAAATGTCTCCCAGTTCCTGTAATAGG
 
. : . : . : . : . : . :
JMFS084A06+ GATCAAAGGGGGAGATGATGGCGCTGCGCAGACTAGCCTTGCGGTTGCTGCTAAGAGCTC
JMFS011D07+ GATCAAAGGGGGAGATGATGGCGCTGCGCAGACTAGCCTTGCGGTTGCTGCTAAGAGCTC
                      ____________________________________________________________
consensus GATCAAAGGGGGAGATGATGGCGCTGCGCAGACTAGCCTTGCGGTTGCTGCTAAGAGCTC
 
. : . : . : . : . : . :
JMFS084A06+ CAAGAGAAGGAAGAATGTTGTTGTTTAAGCTATATTGAGAGCTCATATGAGAGCTCAAAT
JMFS011D07+ CAAGAGAAGGAAGAATGTTGTTGTTTAAGCTATATTGAGAGCTCATATGAGAGCTCAAAT
                      ____________________________________________________________
consensus CAAGAGAAGGAAGAATGTTGTTGTTTAAGCTATATTGAGAGCTCATATGAGAGCTCAAAT
 
. : . : . : . : . : . :
JMFS084A06+ CATCCTTTGCCGAGAGTCTCTCTATCTCGCAGTCGATTTCTCTCATCCCACACATTAGCT
JMFS011D07+ CATCCTTTGCCGAGAGTCTCTCTATCTCGCAGTCGATTTCTCTCATCCCACACATTAGCT
                      ____________________________________________________________
consensus CATCCTTTGCCGAGAGTCTCTCTATCTCGCAGTCGATTTCTCTCATCCCACACATTAGCT
 
. : . : . : . : . : . :
JMFS084A06+ TCCCCTTCCAGGATGCCCCCTTCGTTCTATTCTTTTCACTATTCATTATTATTCTTGCCA
JMFS011D07+ TCCCCTTCCAGGATGCCCCCTTCGTTCTATTCTTTTCACTATTCATTATTATTCTTGCCA
                      ____________________________________________________________
consensus TCCCCTTCCAGGATGCCCCCTTCGTTCTATTCTTTTCACTATTCATTATTATTCTTGCCA
 
. : . : . : . : . : . :
JMFS084A06+ CACACAAGCATATATTATATTAATATAATATATGCATGTGTCTGGCCGTCTTCCCTCGTA
JMFS011D07+ CACACAAGCATATATTATATTAATATAATATATGCATGTGTCTGGCCGTCTTCCCTCGTA
                      ____________________________________________________________
consensus CACACAAGCATATATTATATTAATATAATATATGCATGTGTCTGGCCGTCTTCCCTCGTA
 
. : . : . : . : . : . :
JMFS084A06+ CGTCTGCACAGCATGCAGCGGCTCGGCCACCGGAACCGCCGGTCGCCGACCACTACCGCC
JMFS011D07+ CGTCTGCACAGCATGCAGCGGCTCGGCCACCGGAACCGCCGGTCGCCGACCACTACCGCC
                      ____________________________________________________________
consensus CGTCTGCACAGCATGCAGCGGCTCGGCCACCGGAACCGCCGGTCGCCGACCACTACCGCC
 
. : . : . : . : . : . :
JMFS084A06+ TCGTCAGAACGTGTCTTTCTTGCCTTCCCTTCTCTAGTTGAAGAAAAGTTTTCTGTTT
JMFS011D07+ TCGTCAGAACGTGTCTTTCTTGCCTTCCCTTCTCTAGTTGAAGAAAAGTTTTCTGTTTTC
                      ____________________________________________________________
consensus TCGTCAGAACGTGTCTTTCTTGCCTTCCCTTCTCTAGTTGAAGAAAAGTTTTCTGTTTTC