Previous Contig 002919:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS004F05Sequence394002919 (4)gb:AP003622_18316031e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P063
JMFS011C04Sequence627002919 (4)gb:AP003904_18349949e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ10
JMFS128E02Sequence626002919 (4)gb:AP003904_18349945e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ10
JMFS136C09Sequence601002919 (4)gb:AP003904_18349941e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS128E02+ AAGAATATCAGAGGAATTGAGAGTTGTGCCATTGAAAAAATT
JMFS136C09+ CCATTGAAAAAATT
                      ____________________________________________________________
consensus AAGAATATCAGAGGAATTGAGAGTTGTGCCATTGAAAAAATT
 
. : . : . : . : . : . :
JMFS128E02+ CCCTCCAATACGTTCAGCAAATGTTTGATTTGCTCCAGTCAAGAGTATAGCAGCTGGACA
JMFS136C09+ CCCTCCAATACGTTCAGCAAATGTTTGATTTGCTCCAGTCAAGAGTATAGCAGCTGGACA
JMFS011C04+ TCCAGTCAAGAGTATAGCAGCTGGACA
                      ____________________________________________________________
consensus CCCTCCAATACGTTCAGCAAATGTTTGATTTGCTCCAGTCAAGAGTATAGCAGCTGGACA
 
. : . : . : . : . : . :
JMFS128E02+ GGATCCAGTGGTCTTGCATGACTCTTCAGGCAAATCTTTGTATGTAATAAAATCATTTTG
JMFS136C09+ GGATCCAGTGGTCTTGCATGACTCTTCAGGCAAATCTTTGTATGTAATAAAATCATTTTG
JMFS011C04+ GGATCCAGTGGTCTTGCATGACTCTTCAGGCAAATCTTTGTATGTAATAAAATCATTTTG
                      ____________________________________________________________
consensus GGATCCAGTGGTCTTGCATGACTCTTCAGGCAAATCTTTGTATGTAATAAAATCATTTTG
 
. : . : . : . : . : . :
JMFS128E02+ TACTGCACGATATTCTGGTCTTGGTATCTGTAACAAAGGAGGCCATTCTGGTGGACTAGG
JMFS136C09+ TACTGCACGATATTCTGGTCTTGGTATCTGTAACAAAGGAGGCCATTCTGGTGGACTAGG
JMFS011C04+ TACTGCACGATATTCTGGTCTTGGTATCTGTAACAAAGGAGGCCATTCTGGTGGACTAGG
                      ____________________________________________________________
consensus TACTGCACGATATTCTGGTCTTGGTATCTGTAACAAAGGAGGCCATTCTGGTGGACTAGG
 
. : . : . : . : . : . :
JMFS128E02+ AAGTGGGCAGCTGGCTGCTTGTTCCAAAGTTGAGTACTCAATCCCACACTTTTTTTCACA
JMFS136C09+ AAGTGGGCAGCTGGCTGCTTGTTCCAAAGTTGAGTACTCAATCCCACACTTTTTTTCACA
JMFS004F05+ AGCTGGCTGCTTGTTCCAAAGTTGAGTACTCAATCCCACACTTTTTTTCACA
JMFS011C04+ AAGTGGGCAGCTGGCTGCTTGTTCCAAAGTTGAGTACTCAATCCCACACTTTTTTTCACA
                      ____________________________________________________________
consensus AAGTGGGCAGCTGGCTGCTTGTTCCAAAGTTGAGTACTCAATCCCACACTTTTTTTCACA
 
. : . : . : . : . : . :
JMFS128E02+ TTTTCCATCCCCATTAGTATCAATACAAATGCAGCCACACCTTCTTGAGGGCTTATCCAA
JMFS136C09+ TTTTCCATCCCCATTAGTATCAATACAAATGCAGCCACACCTTCTTGAGGGCTTATCCAA
JMFS004F05+ TTTTCCATCCCCATTAGTATCAATACAAATGCAGCCACACCTTCTTGAGGGCTTATCCAA
JMFS011C04+ TTTTCCATCCCCATTAGTATCAATACAAATGCAGCCACACCTTCTTGAGGGCTTATCCAA
                      ____________________________________________________________
consensus TTTTCCATCCCCATTAGTATCAATACAAATGCAGCCACACCTTCTTGAGGGCTTATCCAA
 
. : . : . : . : . : . :
JMFS128E02+ CTCATTATTTACCACAGTTTGGAGGAGCACAAGCAACACACAGATTAATAGTGGGAATGA
JMFS136C09+ CTCATTATTTACCACAGTTTGGAGGAGCACAAGCAACACACAGATTAATAGTGGGAATGA
JMFS004F05+ CTCATTATTTACCACAGTTTGGAGGAGCACAAGCAACACACAGATTAATAGTGGGAATGA
JMFS011C04+ CTCATTATTTACCACAGTTTGGAGGAGCACAAGCAACACACAGATTAATAGTGGGAATGA
                      ____________________________________________________________
consensus CTCATTATTTACCACAGTTTGGAGGAGCACAAGCAACACACAGATTAATAGTGGGAATGA
 
. : . : . : . : . : . :
JMFS128E02+ AATGAGCCATAGATTTGTCCTCACATTTCGTTTCTGAAATGTCAAATTCTTTCTGAGCAG
JMFS136C09+ AATGAGCCATAGATTTGTCCTCACATTTCGTTTCTGAAATGTCAAATTCTTTCTGAGCAG
JMFS004F05+ AATGAGCCATAGATTTGTCCTCACATTTCGTTTCTGAAATGTCAAATTCTTTCTGAGCAG
JMFS011C04+ AATGAGCCATAGATTTGTCCTCACATTTCGTTTCTGAAATGTCAAATTCTTTCTGAGCAG
                      ____________________________________________________________
consensus AATGAGCCATAGATTTGTCCTCACATTTCGTTTCTGAAATGTCAAATTCTTTCTGAGCAG
 
. : . : . : . : . : . :
JMFS128E02+ AGCATTGGCTTGAGTCCAAAAGCTCGCCGGCCCTTCCGCCATTGATAATCACTCTCTCCA
JMFS136C09+ AGCATTGGCTTGAGTCCAAAAGCTCGCCGGCCCTTCCGCCATTGATAATCACTCTCTCCA
JMFS004F05+ AGCATTGGCTTGAGTCCAAAAGCTCGCCGGCCCTTCCGCCATTGATAATCACTCTCTCCA
JMFS011C04+ AGCATTGGCTTGAGTCCAAAAGCTCGCCGGCCCTTCCGCCATTGATAATCACTCTCTCCA
                      ____________________________________________________________
consensus AGCATTGGCTTGAGTCCAAAAGCTCGCCGGCCCTTCCGCCATTGATAATCACTCTCTCCA
 
. : . : . : . : . : . :
JMFS128E02+ CTCTCTCTCTCTTTCTATCTCAAATGAAAGAGGAAACCAGTAGTAGTGTTTGAGTTAGTA
JMFS136C09+ CTCTCTCTCTCTTTCTATCTCAAATGAAAGAGGAAACCAGTAGTAGTGTTTGAGTTAGTA
JMFS004F05+ CTCTCTCTCTCTTTCTATCTCAAATGAAAGAGGAAACCAGTAGTAGTGTTTGAGTTAGTA
JMFS011C04+ CTCTCTCTCTCTTTCTATCTCAAATGAAAGAGGAAACCAGTAGTAGTGTTTGAGTTAGTA
                      ____________________________________________________________
consensus CTCTCTCTCTCTTTCTATCTCAAATGAAAGAGGAAACCAGTAGTAGTGTTTGAGTTAGTA
 
. : . : . : . : . : . :
JMFS128E02+ TTGAAAGCGTTAAGAAGAAGAAGAAGAAGAGCGCCGAGATGA
JMFS136C09+ TTGAAAGCGTTAAGAAGAAGAAGAAGAAGAGCGCCGAGATGA
JMFS004F05+ TTGAAAGCGTTAAGAAGAAGAAGAAGAAGAGCGCCGAGATGA
JMFS011C04+ TTGAAAGCGTTAAGAAGAAGAAGAAGAAGAGCGCCGAGATGATCGATTTCACCCTCATTT
                      ____________________________________________________________
consensus TTGAAAGCGTTAAGAAGAAGAAGAAGAAGAGCGCCGAGATGATCGATTTCACCCTCATTT
 
. : . : . : . : . : . :
JMFS011C04+ TCAAATACCGTTTCTTCTATATATATATATATATATAGCTTCTCTGCGCATAGTAGTTGA
                      ____________________________________________________________
consensus TCAAATACCGTTTCTTCTATATATATATATATATATAGCTTCTCTGCGCATAGTAGTTGA