Previous Contig 002915:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003E03Sequence603002915 (3)pir|H84514|H845142e-67hypothetical protein At2g14170 [imported] - Arabidopsis thaliana>gb:AC007197_153688008264 (2)pir|H84514|H845143e-83hypothetical protein At2g14170 [imported] - Arabidopsis thaliana>gb:AC007197_153
JMFS010G06Sequence629002915 (3)pir|H84514|H845142e-46hypothetical protein At2g14170 [imported] - Arabidopsis thaliana>gb:AC007197_153
JMSF013G10Sequence545002915 (3)pir|H84514|H845142e-36hypothetical protein At2g14170 [imported] - Arabidopsis thaliana>gb:AC007197_153795008264 (2)pir|H84514|H84514e-100hypothetical protein At2g14170 [imported] - Arabidopsis thaliana>gb:AC007197_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003E03+ CTCTTATGCTATAGGTATCAATTCC
                      ____________________________________________________________
consensus CTCTTATGCTATAGGTATCAATTCC
 
. : . : . : . : . : . :
JMFF003E03+ ATTTGAGACATTAGAAACATATTCTCCCATCTGTAAGGTTGCCATCCCACATGCATGTTC
                      ____________________________________________________________
consensus ATTTGAGACATTAGAAACATATTCTCCCATCTGTAAGGTTGCCATCCCACATGCATGTTC
 
. : . : . : . : . : . :
JMFF003E03+ CACCACCTNTAAGCCACGGAATACATCGCCTTGGGCATCTTTCAATGTCTTCCCCTGTTC
JMFS010G06+ TGGGCATCTTTCAATGTCTTCCCCTGTTC
                      ____________________________________________________________
consensus CACCACCTNTAAGCCACGGAATACATCGCCTTGGGCATCTTTCAATGTCTTCCCCTGTTC
 
. : . : . : . : . : . :
JMFF003E03+ TGTAGTAATATTCAAGGCTAGCTTATCCATGTTCTTCCGTATAAGGTCTTGGTACTTTAA
JMSF013G10+ GTTCTTCCGTATAAGGTCTTGGTACTTTAA
JMFS010G06+ TGTAGTAATATTCAAGGCTAGCTTATCCATGTTCTTCCGTATAAGGTCTTGGTACTTTAA
                      ____________________________________________________________
consensus TGTAGTAATATTCAAGGCTAGCTTATCCATGTTCTTCCGTATAAGGTCTTGGTACTTTAA
 
. : . : . : . : . : . :
JMFF003E03+ CATGACACGCTGCCTTGTCGTGATAGGCGTGTTCTTCCATGATGGATATGCCTTTTTAGC
JMSF013G10+ CATGACACGCTGCCTTGTCGTGATAGGCGTGTTCTTCCATGATGGATATGCCTTTTTAGC
JMFS010G06+ CATGACACGCTGCCTTGTCGTGATAGGCGTGTTCTTCCATGATGGATATGCCTTTTTAGC
                      ____________________________________________________________
consensus CATGACACGCTGCCTTGTCGTGATAGGCGTGTTCTTCCATGATGGATATGCCTTTTTAGC
 
. : . : . : . : . : . :
JMFF003E03+ AGCAGAAACTGCAGACTTGAACTCCTCATTCGTAGTTAACGGTATCTGAGACACCACTTC
JMSF013G10+ AGCAGAAACTGCAGACTTGAACTCCTCATTCGTAGTTAACGGTATCTGAGACACCACTTC
JMFS010G06+ AGCAGAAACTGCAGACTTGAACTCCTCATTCGTAGTTAACGGTATCTGAGACACCACTTC
                      ____________________________________________________________
consensus AGCAGAAACTGCAGACTTGAACTCCTCATTCGTAGTTAACGGTATCTGAGACACCACTTC
 
. : . : . : . : . : . :
JMFF003E03+ TTGTGTAGCTGGGTTTATAACATCAATTGATTCCGATGACTTCGAATCTACAAAGCTGCC
JMSF013G10+ TTGTGTAGCTGGGTTTATAACATCAATTGATTCCGATGACTTCGAATCTACAAAGCTGCC
JMFS010G06+ TTGTGTAGCTGGGTTTATAACATCAATTGATTCCGATGACTTCGAATCTACAAAGCTGCC
                      ____________________________________________________________
consensus TTGTGTAGCTGGGTTTATAACATCAATTGATTCCGATGACTTCGAATCTACAAAGCTGCC
 
. : . : . : . : . : . :
JMFF003E03+ ACCAATCAAATTGGGAAGCCTCGGCGAAGTTCGATGCTTCCACGAGGGCTCAGCTGCGGT
JMSF013G10+ ACCAATCAAATTGGGAAGCCTCGGCGAAGTTCGATGCTTCCACGAGGGCTCAGCTGCGGT
JMFS010G06+ ACCAATCAAATTGGGAAGCCTCGGCGAAGTTCGATGCTTCCACGAGGGCTCAGCTGCGGT
                      ____________________________________________________________
consensus ACCAATCAAATTGGGAAGCCTCGGCGAAGTTCGATGCTTCCACGAGGGCTCAGCTGCGGT
 
. : . : . : . : . : . :
JMFF003E03+ GGATAAATGAGAATTAGCAAGACAATAAATCTGAGGACTCAAAGACCTCACATTTCTAGC
JMSF013G10+ GGATAAATGAGAATTAGCAAGACAATAAATCTGAGGACTCAAAGACCTCACATTTCTAGC
JMFS010G06+ GGATAAATGAGAATTAGCAAGACAATAAATCTGAGGACTCAAAGACCTCACATTTCTAGC
                      ____________________________________________________________
consensus GGATAAATGAGAATTAGCAAGACAATAAATCTGAGGACTCAAAGACCTCACATTTCTAGC
 
. : . : . : . : . : . :
JMFF003E03+ TCGATTGACGGCGAACTGCATCATCATTATCCCCGGAAATCTGTGATCGGAATCGATAAA
JMSF013G10+ TCGATTGACGGCGAACTGCATCATCATTATCCCCGGAAATCTGTGATCGGAATCGATAAA
JMFS010G06+ TCGATTGACGGCGAACTGCATCATCATTATCCCCGGAAATCTGTGATCGGAATCGATAAA
                      ____________________________________________________________
consensus TCGATTGACGGCGAACTGCATCATCATTATCCCCGGAAATCTGTGATCGGAATCGATAAA
 
. : . : . : . : . : . :
JMFF003E03+ GATTTCCCGGAGTCCTCTACCTTGCTTCTCTACTCAAC
JMSF013G10+ GATTTCCCGGAGTCCTCTACCTTGCTTCTCTACTCAACTCTCTCACTTGGGTATGTCAAT
JMFS010G06+ GATTTCCCGGAGTCCTCTACCTTGCTTCTCTACTCAACTCTCTCACTTGGGTATGTCAAT
                      ____________________________________________________________
consensus GATTTCCCGGAGTCCTCTACCTTGCTTCTCTACTCAACTCTCTCACTTGGGTATGTCAAT
 
. : . : . : . : . : . :
JMSF013G10+ TTGGAGTATATAGTAAAAAGAGAGTGAATCAAAAATTACAACTTTGGAAATTTTTTAAAT
JMFS010G06+ TTGGAGTATATAGTAAAAAGAGAGTGAATCAAAAATTACAACTTTGGAAATTTTTTAAAT
                      ____________________________________________________________
consensus TTGGAGTATATAGTAAAAAGAGAGTGAATCAAAAATTACAACTTTGGAAATTTTTTAAAT
 
. : . : . : . : . : . :
JMSF013G10+ TGGGTATTATCACATTGAGCCGATAAGGATTAAT
JMFS010G06+ TGGGTATTATCACATTGAGCCGATAAGGATTAATGAGTTGAAGAACGTGAACTGTTCCAG
                      ____________________________________________________________
consensus TGGGTATTATCACATTGAGCCGATAAGGATTAATGAGTTGAAGAACGTGAACTGTTCCAG