Previous Contig 002914:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010B24Sequence421002914 (4)pir|T51245|T512458e-09COP1-interacting protein CIP8 [imported] - Arabidopsis thaliana>gb:AB019236_1514789002914 (4)pir|T51245|T512459e-52COP1-interacting protein CIP8 [imported] - Arabidopsis thaliana>gb:AB019236_1514
JMFN018H15Sequence623002914 (4)pir|T51245|T512452e-08COP1-interacting protein CIP8 [imported] - Arabidopsis thaliana>gb:AB019236_1514
JMFS010G04Sequence601002914 (4)pir|T51245|T512452e-08COP1-interacting protein CIP8 [imported] - Arabidopsis thaliana>gb:AB019236_1514

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010B24- CTTAAGAGGTAAATTTTGAAGCTGTGTATTGGAAGAACTTATTTA
                      ____________________________________________________________
consensus CTTAAGAGGTAAATTTTGAAGCTGTGTATTGGAAGAACTTATTTA
 
. : . : . : . : . : . :
rJMFF010B24- CATTCAAAGATTACAGCACTTTCATCCAACTAATCCACAAGGAGTTCTGATAAAAGAACA
                      ____________________________________________________________
consensus CATTCAAAGATTACAGCACTTTCATCCAACTAATCCACAAGGAGTTCTGATAAAAGAACA
 
. : . : . : . : . : . :
rJMFF010B24- GGAAATCTAAAATTGGAGGTAAAAAGGAGTGCGAATGAATGAGAAGGTAGATTTACCATG
                      ____________________________________________________________
consensus GGAAATCTAAAATTGGAGGTAAAAAGGAGTGCGAATGAATGAGAAGGTAGATTTACCATG
 
. : . : . : . : . : . :
rJMFF010B24- ATAAGTCAATCACATCCTTCACTGCTGGCTGCAGCAGTGGAAGAACTGGAGGAAAAGTTG
                      ____________________________________________________________
consensus ATAAGTCAATCACATCCTTCACTGCTGGCTGCAGCAGTGGAAGAACTGGAGGAAAAGTTG
 
. : . : . : . : . : . :
rJMFF010B24- GAAGGTTTGCTCTTTCTTTCATCTTCGTACTCGGGATCATCTGTAGCTAACTCAAACCTA
                      ____________________________________________________________
consensus GAAGGTTTGCTCTTTCTTTCATCTTCGTACTCGGGATCATCTGTAGCTAACTCAAACCTA
 
. : . : . : . : . : . :
rJMFF010B24- CAAACAGGGCATGAATTCCTGGAACCCAACCATGGCACTATACATTCCCCATGATATCTA
                      ____________________________________________________________
consensus CAAACAGGGCATGAATTCCTGGAACCCAACCATGGCACTATACATTCCCCATGATATCTA
 
. : . : . : . : . : . :
rJMFF010B24- TGACCACATGGCAATTCCTTTGCCGTTTCACCTGTGCTTACAGAATCTTTGCATATAGCA
                      ____________________________________________________________
consensus TGACCACATGGCAATTCCTTTGCCGTTTCACCTGTGCTTACAGAATCTTTGCATATAGCA
 
. : . : . : . : . : . :
rJMFF010B24- CAGACTAGTTCCTCCAGCTCGCTTTTAATCACGACTGTAGGCAAAGCTTCTATGGCAGTT
                      ____________________________________________________________
consensus CAGACTAGTTCCTCCAGCTCGCTTTTAATCACGACTGTAGGCAAAGCTTCTATGGCAGTT
 
. : . : . : . : . : . :
rJMFF010B24- TTTGAAGCTGGCGGAGCTCCCCGTCTTCCACCATTATCACTTTCAGCTAAGTTTTGCAGT
                      ____________________________________________________________
consensus TTTGAAGCTGGCGGAGCTCCCCGTCTTCCACCATTATCACTTTCAGCTAAGTTTTGCAGT
 
. : . : . : . : . : . :
rJMFF010B24- AAGGCTTCGTAGCCTGCAGCGTCCACGTAATCGCCAGGGTTTCCAAAGTAGCCATCGCCC
                      ____________________________________________________________
consensus AAGGCTTCGTAGCCTGCAGCGTCCACGTAATCGCCAGGGTTTCCAAAGTAGCCATCGCCC
 
. : . : . : . : . : . :
rJMFF010B24- TCAGGAACTTGTAATCGGAACTCGATTGAGTGGTCTTCGAGCCCCATCAGAATCTCCGCC
                      ____________________________________________________________
consensus TCAGGAACTTGTAATCGGAACTCGATTGAGTGGTCTTCGAGCCCCATCAGAATCTCCGCC
 
. : . : . : . : . : . :
rJMFF010B24- CAATCGAGAATCCGATTGCGGCGGCTAGCAGCTCGAGCCGCGAGGTCGCGAAGCCGAAGA
JMFN018H15+ GCGGCGGCTAGCAGCTCGAGCCGCGAGGTCGCGAAGCCGAAGA
JMFS010G04+ A
                      ____________________________________________________________
consensus CAATCGAGAATCCGATTGCGGCGGCTAGCAGCTCGAGCCGCGAGGTCGCGAAGCCGAAGA
 
. : . : . : . : . : . :
rJMFF010B24- CGGAGCACATCGCGCTGCCTTCGCCGGAAATCCTCTTCCTCTCTCTCGCCGTGATTCTCG
JMFN018H15+ CGGAGCACATCGCGCTGCCTTCGCCGGAAATCCTCTTCCTCTCTCTCGCCGTGATTCTCG
JMFS010G04+ CGGAGCACATCGCGCTGCCTTCGCCGGAAATCCTCTTCCTCTCTCTCGCCGTGATTCTCG
                      ____________________________________________________________
consensus CGGAGCACATCGCGCTGCCTTCGCCGGAAATCCTCTTCCTCTCTCTCGCCGTGATTCTCG
 
. : . : . : . : . : . :
rJMFF010B24- TCCCCTTCGTCATCGTCGTCTTCC
JMFN018H15+ TCCCCTTCGTCATCGTCGTCTTCCTCATCCGATTCGTTTCGATTCTCCTCCTCTAGGTCT
JMFS010G04+ TCCCCTTCGTCATCGTCGTCTTCCTCATCCGATTCGTTTCGATTCTCCTCCTCTAGGTCT
                      ____________________________________________________________
consensus TCCCCTTCGTCATCGTCGTCTTCCTCATCCGATTCGTTTCGATTCTCCTCCTCTAGGTCT
 
. : . : . : . : . : . :
JMFN018H15+ TGATTTTCTTCATCCTCATTTCTGCCTTCCACTTCGTCGTCCTCATCCTCGTCGCCGTTG
JMFF010B24+ CTCGTCGCCGTTG
JMFS010G04+ TGATTTTCTTCATCCTCATTTCTGCCTTCCACTTCGTCGTCCTCATCCTCGTCGCCGTTG
                      ____________________________________________________________
consensus TGATTTTCTTCATCCTCATTTCTGCCTTCCACTTCGTCGTCCTCATCCTCGTCGCCGTTG
 
. : . : . : . : . : . :
JMFN018H15+ TCCCACCCTCCGATTTCAACTCGGAGATAATCGTCATCGGATGGATCCGCGTGCTCAGAC
JMFF010B24+ TCCCACCCTCCGATTTCAACTCGGAGATAATCGTCATCGGATGGATCCGCGTGCTCAGAC
JMFS010G04+ TCCCACCCTCCGATTTCAACTCGGAGATAATCGTCATCGGATGGATCCGCGTGCTCAGAC
                      ____________________________________________________________
consensus TCCCACCCTCCGATTTCAACTCGGAGATAATCGTCATCGGATGGATCCGCGTGCTCAGAC
 
. : . : . : . : . : . :
JMFN018H15+ GGCGGAGGAGGAGGAGTGTCGTCCTCACGCGCGGCCTGAGCGATTAGGCGAAGGACTTGG
JMFF010B24+ GGCGGAGGAGGAGGAGTGTCGTCCTCACGCGCGGCCTGAGCGATTAGGCGAAGGACTTGG
JMFS010G04+ GGCGGAGGAGGAGGAGTGTCGTCCTCACGCGCGGCCTGAGCGATTAGGCGAAGGACTTGG
                      ____________________________________________________________
consensus GGCGGAGGAGGAGGAGTGTCGTCCTCACGCGCGGCCTGAGCGATTAGGCGAAGGACTTGG
 
. : . : . : . : . : . :
JMFN018H15+ AAGAACTGATTGCTGAAATTAGCCTCGTCGATCTGATCAGGTGCCGCTTCTGGGGCTGGA
JMFF010B24+ AAGAACTGATTGCTGAAATTAGCCTCGTCGATCTGATCAGGTGCCGCTTCTGGGGCTGGA
JMFS010G04+ AAGAACTGATTGCTGAAATTAGCCTCGTCGATCTGATCAGGTGCCGCTTCTGGGGCTGGA
                      ____________________________________________________________
consensus AAGAACTGATTGCTGAAATTAGCCTCGTCGATCTGATCAGGTGCCGCTTCTGGGGCTGGA
 
. : . : . : . : . : . :
JMFN018H15+ AGAGGCGCAGCAACGGCGGCGATGGACTCCACAAAGCCGTTTTTGCACTCGTGGCAGATA
JMFF010B24+ AGAGGCGCAGCAACGGCGGCGATGGACTCCACAAAGCCGTTTTTGCACTCGTGGCAGATA
JMFS010G04+ AGAGGCGCAGCAACGGCGGCGATGGACTCCACAAAGCCGTTTTTGCACTCGTGGCAGATA
                      ____________________________________________________________
consensus AGAGGCGCAGCAACGGCGGCGATGGACTCCACAAAGCCGTTTTTGCACTCGTGGCAGATA
 
. : . : . : . : . : . :
JMFN018H15+ ACATCAGGAAGATCCGCTATGGTTTCAATGGAGACCCGTTTATCACAGTGATAGCACCAG
JMFF010B24+ ACATCAGGAAGATCCGCTATGGTTTCAATGGAGACCCGTTTATCACAGTGATAGCACCAG
JMFS010G04+ ACATCAGGAAGATCCGCTATGGTTTCAATGGAGACCCGTTTATCACAGTGATAGCACCAG
                      ____________________________________________________________
consensus ACATCAGGAAGATCCGCTATGGTTTCAATGGAGACCCGTTTATCACAGTGATAGCACCAG
 
. : . : . : . : . : . :
JMFN018H15+ TACTGCAACGTATCCGGGTCAGACCCTGCATAAGCCTGAGATTGAGACAGAGTTCCGTTT
JMFF010B24+ TACTGCAACGTATCCGGGTCAGACCCTGCATAAGCCTGAGATTGAGACAGAGTTCCGTTT
JMFS010G04+ TACTGCAACGTATCCGGGTCAGACCCTGCATAAGCCTGAGATTGAGACAGAGTTCCGTTT
                      ____________________________________________________________
consensus TACTGCAACGTATCCGGGTCAGACCCTGCATAAGCCTGAGATTGAGACAGAGTTCCGTTT
 
. : . : . : . : . : . :
JMFN018H15+ GGGGATTCCGCCATGGGAGAGTCTGCGGTGGTACGATATG
JMFF010B24+ GGGGATTCCGCCATGGGAGAGTCTGCGGTGGTACGATATGGACCAGAT
JMFS010G04+ GGGGATTCCGCCATGGGAGAGTCTGCGGTGGTACGATATGGACCAGATACGACTTGGAAA
                      ____________________________________________________________
consensus GGGGATTCCGCCATGGGAGAGTCTGCGGTGGTACGATATGGACCAGATACGACTTGGAAA