Previous Contig 002903:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019A03Sequence276002903 (3)438002903 (3)
JMFS009G03Sequence597002903 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS009G03+ GTTGGATTGGGATTAGGGTTTGGATTGGGATCTTGATTATTGTTGTTGTTAATGAAG
                      ____________________________________________________________
consensus GTTGGATTGGGATTAGGGTTTGGATTGGGATCTTGATTATTGTTGTTGTTAATGAAG
 
. : . : . : . : . : . :
JMFS009G03+ GCTCTCATGGAGGAAGTGAGAGAAGAGAGAGCATCATCTGATGACATCATTTTTTTTTTT
                      ____________________________________________________________
consensus GCTCTCATGGAGGAAGTGAGAGAAGAGAGAGCATCATCTGATGACATCATTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF019A03- AAAGAAGAGCCAAAATCTATGGATGTAT
JMFS009G03+ TTTTGGTTTTTTTTTTCAGCTTCTGCAAATTTAAAGAAGAGCCAAAATCTATGGATGTAT
                      ____________________________________________________________
consensus TTTTGGTTTTTTTTTTCAGCTTCTGCAAATTTAAAGAAGAGCCAAAATCTATGGATGTAT
 
. : . : . : . : . : . :
rJMFF019A03- GTATAAAGCAGCCAAGCAACAGAGAGAAGAAGAAACAAAAGGATTTTGCTGAAAACAGCT
JMFS009G03+ GTATAAAGCAGCCAAGCAACAGAGAGAAGAAGAAACAAAAGGATTTTGCTGAAAACAGCT
                      ____________________________________________________________
consensus GTATAAAGCAGCCAAGCAACAGAGAGAAGAAGAAACAAAAGGATTTTGCTGAAAACAGCT
 
. : . : . : . : . : . :
rJMFF019A03- AAATCCCAANATGTTACACTGTTTTATGNGTAGCANAAAGGCTAAAACAACAAAACCAGA
JMFS009G03+ AAATCCCAAGATGTTACACTGTTTTATGTGTAGCAGAAAGGCTAAAACAACAAAACCAGA
                      ____________________________________________________________
consensus AAATCCCAAGATGTTACACTGTTTTATGTGTAGCAGAAAGGCTAAAACAACAAAACCAGA
 
. : . : . : . : . : . :
JMFF019A03+ GATTAGAAAATTGTTTACATCTGCANGACACCATCTTCTTCTTCATCTCT
rJMFF019A03- ANATGATGATGATTANAAAATTGTTTACATCTGCATGACACCATCTTCTTCTTCATCTCT
JMFS009G03+ AGATGATGATGATTAGAAAATTGTTTACATCTGCATGACACCATCTTCTTCTTCATCTCT
                      ____________________________________________________________
consensus AGATGATGATGATTAGAAAATTGTTTACATCTGCATGACACCATCTTCTTCTTCATCTCT
 
. : . : . : . : . : . :
JMFF019A03+ TCTTCTACAGATCTCTCTCTCTCTCTCTTTCTTTCTTTATTTCTTAGCTTCTTCTTCTTC
rJMFF019A03- TCTTCTACANATCTCTCTCTCTCTCTCTTTCTTTCTTTATTTCTTANCTTCTTCTTCTTC
JMFS009G03+ TCTTCTACAGATCTCTCTCTCTCTCTCTTTCTTTCTTTATTTCTTAGCTTCTTCTTCTTC
                      ____________________________________________________________
consensus TCTTCTACAGATCTCTCTCTCTCTCTCTTTCTTTCTTTATTTCTTAGCTTCTTCTTCTTC
 
. : . : . : . : . : . :
JMFF019A03+ TTCGTTTTGATTCTGGGTTTTGGAGGGCTTTAGCAGCAGCAAAACTCCATAAAACTACAA
rJMFF019A03- TTCGTTTTGATTCNGGGTTTNGGAGGGCTTTANCAGCANCAAAACTCCATAAAACTACAA
JMFS009G03+ TTCGTTTTGATTCTGGGTTTTGGAGGGCTTTAGCAGCAGCAAAACTCCATAAAACTACAA
                      ____________________________________________________________
consensus TTCGTTTTGATTCTGGGTTTTGGAGGGCTTTAGCAGCAGCAAAACTCCATAAAACTACAA
 
. : . : . : . : . : . :
JMFF019A03+ CTATGGCAGCTACCAAGAAGGAATATTTCTTATNTAATTTCTTCTTCTTCTTCTTCTTCT
rJMFF019A03- CTATGGCAGCTACCAANAAGGAATATTTCTTATTTAATTTCTTCTTCTTCTTCTTCTTCT
JMFS009G03+ CTATGGCAGCTACCAAGAAGGAATATTTCTTATTTAATTTCTTCTTCTTCTTCTTCTTCT
                      ____________________________________________________________
consensus CTATGGCAGCTACCAAGAAGGAATATTTCTTATTTAATTTCTTCTTCTTCTTCTTCTTCT
 
. : . : . : . : . : . :
JMFF019A03+ TCTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTTGC
rJMFF019A03- TCTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTTGC
JMFS009G03+ TCTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTTGCTCCTATCTCTTTCCCTCGTG
                      ____________________________________________________________
consensus TCTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTTGCTCCTATCTCTTTCCCTCGTG