Previous Contig 002901:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS009F07Sequence616002901 (3)
JMFS133C05Sequence626002901 (3)gb:AP002040_18215869e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEC18.
JMFS147G06Sequence606002901 (3)gb:AP002040_18215862e-11Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEC18.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS133C05+ CCAAAAACTCTATCATATGGATAAGCTATTGATGGATTATGCTCATTCCTCACAATA
                      ____________________________________________________________
consensus CCAAAAACTCTATCATATGGATAAGCTATTGATGGATTATGCTCATTCCTCACAATA
 
. : . : . : . : . : . :
JMFS133C05+ GTATCACCATCTGCATACCATGCAATTTCCTCCCCTTGTCGAATCTCTCTTGGGCTTAGA
JMFS147G06+ TGGGCTTAGA
                      ____________________________________________________________
consensus GTATCACCATCTGCATACCATGCAATTTCCTCCCCTTGTCGAATCTCTCTTGGGCTTAGA
 
. : . : . : . : . : . :
JMFS133C05+ GGCCTAAACCGCACTGTCACCGTAACATTTTCCTTGGACCTTTCCGCATTCAGAGGTAAA
JMFS147G06+ GGCCTAAACCGCACTGTCACCGTAACATTTTCCTTGGACCTTTCCGCATTCAGAGGTAAA
JMFS009F07+ CGCATTCAGAGGTAAA
                      ____________________________________________________________
consensus GGCCTAAACCGCACTGTCACCGTAACATTTTCCTTGGACCTTTCCGCATTCAGAGGTAAA
 
. : . : . : . : . : . :
JMFS133C05+ TTTTCAGTGTAATAGTACTGAGGCTTACTCCTGGCGGATGATGACGCCGGCGAACTCACG
JMFS147G06+ TTTTCAGTGTAATAGTACTGAGGCTTACTCCTGGCGGATGATGACGCCGGCGAACTCACG
JMFS009F07+ TTTTCAGTGTAATAGTACTGAGGCTTACTCCTGGCGGATGATGACGCCGGCGAACTCACG
                      ____________________________________________________________
consensus TTTTCAGTGTAATAGTACTGAGGCTTACTCCTGGCGGATGATGACGCCGGCGAACTCACG
 
. : . : . : . : . : . :
JMFS133C05+ CCGTCAATAAAATTTTCCGGGAACTGTTTTGATGATGAAGTAGTTGATGACGTTGGGGAA
JMFS147G06+ CCGTCAATAAAATTTTCCGGGAACTGTTTTGATGATGAAGTAGTTGATGACGTTGGGGAA
JMFS009F07+ CCGTCAATAAAATTTTCCGGGAACTGTTTTGATGATGAAGTAGTTGATGACGTTGGGGAA
                      ____________________________________________________________
consensus CCGTCAATAAAATTTTCCGGGAACTGTTTTGATGATGAAGTAGTTGATGACGTTGGGGAA
 
. : . : . : . : . : . :
JMFS133C05+ TTCGCCACTCTTGAGCTCGATTTTTGAGATTTTGTTCCTTGTCTTGTAGTCATTTTAGCT
JMFS147G06+ TTCGCCACTCTTGAGCTCGATTTTTGAGATTTTGTTCCTTGTCTTGTAGTCATTTTAGCT
JMFS009F07+ TTCGCCACTCTTGAGCTCGATTTTTGAGATTTTGTTCCTTGTCTTGTAGTCATTTTAGCT
                      ____________________________________________________________
consensus TTCGCCACTCTTGAGCTCGATTTTTGAGATTTTGTTCCTTGTCTTGTAGTCATTTTAGCT
 
. : . : . : . : . : . :
JMFS133C05+ TCAATCAGTCAGATTAGCATCAAATCATCCACGCGAGCCGAGAAATCTATGTGCTTTGCG
JMFS147G06+ TCAATCAGTCAGATTAGCATCAAATCATCCACGCGAGCCGAGAAATCTATGTGCTTTGCG
JMFS009F07+ TCAATCAGTCAGATTAGCATCAAATCATCCACGCGAGCCGAGAAATCTATGTGCTTTGCG
                      ____________________________________________________________
consensus TCAATCAGTCAGATTAGCATCAAATCATCCACGCGAGCCGAGAAATCTATGTGCTTTGCG
 
. : . : . : . : . : . :
JMFS133C05+ TATGAATTGAACAACAACAAAAATAAAAATAAAAAAATACAGATACAGGGAGAAGCAAAC
JMFS147G06+ TATGAATTGAACAACAACAAAAATAAAAATAAAAAAATACAGATACAGGGAGAAGCAAAC
JMFS009F07+ TATGAATTGAACAACAACAAAAATAAAAATAAAAAAATACAGATACAGGGAGAAGCAAAC
                      ____________________________________________________________
consensus TATGAATTGAACAACAACAAAAATAAAAATAAAAAAATACAGATACAGGGAGAAGCAAAC
 
. : . : . : . : . : . :
JMFS133C05+ GAATCTTCGGAATGAGGGAGGGATGAAGATCTAACAAGTGACGAAAAACATCATCATTCC
JMFS147G06+ GAATCTTCGGAATGAGGGAGGGATGAAGATCTAACAAGTGACGAAAAACATCATCATTCC
JMFS009F07+ GAATCTTCGGAATGAGGGAGGGATGAAGATCTAACAAGTGACGAAAAACATCATCATTCC
                      ____________________________________________________________
consensus GAATCTTCGGAATGAGGGAGGGATGAAGATCTAACAAGTGACGAAAAACATCATCATTCC
 
. : . : . : . : . : . :
JMFS133C05+ CCCATCATAATTAGCTGCGCCAATCTCTCACGCACATTCACACTCACTGCGTGTTTTCGT
JMFS147G06+ CCCATCATAATTAGCTGCGCCAATCTCTCACGCACATTCACACTCACTGCGTGTTTTCGT
JMFS009F07+ CCCATCATAATTAGCTGCGCCAATCTCTCACGCACATTCACACTCACTGCGTGTTTTCGT
                      ____________________________________________________________
consensus CCCATCATAATTAGCTGCGCCAATCTCTCACGCACATTCACACTCACTGCGTGTTTTCGT
 
. : . : . : . : . : . :
JMFS133C05+ GTGGTATGGATAGAGCGGAAGAAGAATAA
JMFS147G06+ GTGGTATGGATAGAGCGGAAGAAGAATAAGAGAGTGTTTGGATATTATTTTCCTAAGCTT
JMFS009F07+ GTGGTATGGATAGAGCGGAAGAAGAATAAGAGAGTGTTTGGATATTATTTTCCTAAGCTT
                      ____________________________________________________________
consensus GTGGTATGGATAGAGCGGAAGAAGAATAAGAGAGTGTTTGGATATTATTTTCCTAAGCTT
 
. : . : . : . : . : . :
JMFS147G06+ TTCCCCTTTAAGCTTGCCTTGGAAGCGATGCCTGATGCCTTTTCTCTCTCTCTTGT
JMFS009F07+ TTCCCCTTTAAGCTTGCCTTGGAAGCGATGCCTGATGCCTTTTCTCTCTCTCTTGTTCTC
                      ____________________________________________________________
consensus TTCCCCTTTAAGCTTGCCTTGGAAGCGATGCCTGATGCCTTTTCTCTCTCTCTTGTTCTC
 
. : . : . : . : . : . :
JMFS009F07+ TCTCTAAAGCATTCATGGAGCCCAACTGAACCGCACACAACGTCAATACATACAGACTTT
                      ____________________________________________________________
consensus TCTCTAAAGCATTCATGGAGCCCAACTGAACCGCACACAACGTCAATACATACAGACTTT