Previous Contig 002899:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034O22Sequence483002899 (18)gb:AY048248_15617097e-67Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A671010486 (14)gb:AP003760_18330513e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFF039K23Sequence552002899 (18)gb:AY048248_15617092e-71Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A739010486 (14)gb:AP003760_18330511e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFF044P22Sequence634002899 (18)gb:AY048248_15617092e-77Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A553010486 (14)gb:AP003760_18330513e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFF046N14Sequence477002899 (18)gb:AY048248_15617091e-68Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A460010486 (14)gb:AP003760_18330512e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFS009E11Sequence620002899 (18)gb:AY048248_15617091e-72Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMFS025D01Sequence287002899 (18)gb:AY048248_15617093e-33Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMFS042F06Sequence627002899 (18)gb:AY048248_15617098e-81Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMFS084A02Sequence619002899 (18)gb:AY048248_15617094e-81Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMFS097A05Sequence624002899 (18)gb:AY048248_15617093e-79Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMFS097A10Sequence490002899 (18)gb:AY048248_15617099e-10Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMFS169E10Sequence614002899 (18)gb:AY048248_15617099e-79Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMSF001K06Sequence405002899 (18)gb:AY048248_15617097e-56Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A755010486 (14)gb:AY048248_15617099e-43Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A
JMSF024I11Sequence659002899 (18)gb:AY048248_15617092e-81Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A757010486 (14)gb:AP003760_18330513e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF024M05Sequence648002899 (18)gb:AY048248_15617093e-76Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A774010486 (14)gb:AP003760_18330512e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF031O17Sequence657002899 (18)gb:AY048248_15617098e-81Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A752010486 (14)gb:AP003760_18330512e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF032F15Sequence661002899 (18)gb:AY048248_15617092e-81Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A784010486 (14)gb:AP003760_18330517e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF041I08Sequence806002899 (18)gb:AY048248_15617092e-91Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A629010486 (14)gb:AP003760_18330513e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF047A24Sequence674002899 (18)gb:AY048248_15617092e-82Arabidopsis thaliana At2g38020/T8P21.7 mRNA, complete cds.>gb:AY139799_1582404 A740010486 (14)gb:AP003760_18330516e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I08+ CGGTCATGACCAGAAGTCTACCATCATGTGTAAACGACGCCAGCAGCTTCCCATTCC
                      ____________________________________________________________
consensus CGGTCATGACCAGAAGTCTACCATCATGTGTAAACGACGCCAGCAGCTTCCCATTCC
 
. : . : . : . : . : . :
JMSF047A24+ TGAATCCCGTCNT
JMSF041I08+ GCGAAACCACCATCTTCTGCAACGGCCCAATTCCAACTCCCAGCTGCTGAATCCCGTCCT
                      ____________________________________________________________
consensus GCGAAACCACCATCTTCTGCAACGGCCCAATTCCAACTCCCAGCTGCTGAATCCCGTCCT
 
. : . : . : . : . : . :
JMSF047A24+ CTTCTACCAATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMSF032F15+ TCTACCAATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMFF044P22+ ACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMSF031O17+ TAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMFS042F06+ AATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMFS169E10+ CTGCCATCAGCACTTCCACATTTCCAGACATGG
JMFS097A05+ TACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMFS084A02+ TACCAATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMSF024I11+ TCTACCAATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMSF041I08+ CTTCTACCAATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
JMSF024M05+ CCAGACATGG
                      ____________________________________________________________
consensus CTTCTACCAATAACACGTGATCCCCTACTGCCATCAGCACTTCCACATTTCCAGACATGG
 
. : . : . : . : . : . :
JMSF047A24+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMSF032F15+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFF044P22+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMSF031O17+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFS042F06+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFS169E10+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFS097A05+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFS084A02+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMSF024I11+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFF039K23+ CAGGATCCGCCA
JMSF041I08+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMSF024M05+ TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
JMFS009E11+ GCGGAAAGTCCTCCAAACCAGGATCCGCCA
                      ____________________________________________________________
consensus TGTACTGGGGCTCGATCACCGTCATAGAGAGCGGAAAGTCCTCCAAACCAGGATCCGCCA
 
. : . : . : . : . : . :
JMSF047A24+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMSF032F15+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFF044P22+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMSF031O17+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFS042F06+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFS169E10+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFS097A05+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFS084A02+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMSF024I11+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFF039K23+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMSF041I08+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMSF024M05+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFF034O22+ AGGCCTCGTTGA
JMFF046N14+ TCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
JMFS009E11+ GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
                      ____________________________________________________________
consensus GCTTGATCGGGTTCGGATTCTTGAAATCGGGTATGCAGAAGACCTGAAAGGCCTCGTTGA
 
. : . : . : . : . : . :
JMSF047A24+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMSF032F15+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFF044P22+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMSF031O17+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFS042F06+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFS169E10+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFS097A05+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFS084A02+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMSF024I11+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFF039K23+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMSF041I08+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMSF024M05+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFS097A10+ GACGCCGGTATTCCAGAAGACGCAATCCACCACACTGTGCGTCAAGCAGTCTT
JMFF034O22+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFF046N14+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
JMFS009E11+ TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
                      ____________________________________________________________
consensus TGCAAACGACGCCGTTATGCCAGAAGACGCAATCCACCACACTGTGCGTGAAGCAGTCTT
 
. : . : . : . : . : . :
JMSF047A24+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMSF032F15+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFF044P22+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMSF031O17+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFS042F06+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFS169E10+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFS097A05+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFS084A02+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMSF024I11+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFF039K23+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMSF041I08+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMSF024M05+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFS097A10+ TGCCGAGGTGAGAGCGATTCCACAGGCTCTGCGCGGATGTCAGTACCGGTAGTCGGTGCC
JMFF034O22+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFF046N14+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMSF001K06+ G-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
JMFS009E11+ TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
                      ____________________________________________________________
consensus TGCCGAGG-GAGAGCGATTCCAGAGGCTCTGCGCGGATGTC-GTAGCGGTAAACGGTGCC
 
. : . : . : . : . : . :
JMSF047A24+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMSF032F15+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFF044P22+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMSF031O17+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFS042F06+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFS169E10+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFS097A05+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFS084A02+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMSF024I11+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFF039K23+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMSF041I08+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMSF024M05+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFS097A10+ GTCCTGAGTAATGCAGTATCAGCGTCTGGTCGTCGGTCCAGAACATGCCGTCGAGTCGGC
JMFF034O22+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFF046N14+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMSF001K06+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
JMFS009E11+ GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
                      ____________________________________________________________
consensus GTCCTGAGTAATGCAG-ATCAGCGTCTGGTCGTCGGTCCAGGACATGCCGACGAGACGGC
 
. : . : . : . : . : . :
JMSF047A24+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMSF032F15+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFF044P22+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGT-CGCCGGCGGAGTTGAAGATTCGG
JMSF031O17+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS042F06+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS169E10+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS097A05+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS084A02+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGAGGAGTTGAAGATTCGG
JMSF024I11+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFF039K23+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGT-CGCCGGCGGAGTTGAAGATTCGG
JMSF041I08+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMSF024M05+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS097A10+ GGTCAGGGTTTCTCCAGACAGTTTGTGCGATGTGAATCGCCGTCGTAGTTGAAGATTCGG
JMFF034O22+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFF046N14+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMSF001K06+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS025D01+ TGGA-CGCCGGCGGAGTTGAAGATTCGG
JMFS009E11+ CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
                      ____________________________________________________________
consensus CGCCAGGGTTCTTCCAGACAGTTTCTGCGATCTGGA-CGCCGGCGGAGTTGAAGATTCGG
 
. : . : . : . : . : . :
JMSF047A24+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMSF032F15+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFF044P22+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTNGGCGTCGTCGCGGATAA
JMSF031O17+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS042F06+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS169E10+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS097A05+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS084A02+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMSF024I11+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFF039K23+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMSF041I08+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMSF024M05+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS097A10+ AGCTTCCGAAGGGCGTACTTGCGCTGTAGAGCTGTACGATTTTGGAGTCGTCGCGGATAT
JMFF034O22+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFF046N14+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMSF001K06+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS025D01+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
JMFS009E11+ AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
                      ____________________________________________________________
consensus AGCTTCCGGAGGGCGGACT--CGGCGTAGAGCTGGACGATCTTGGCGTCGTCGCGGATAA
 
. : . : . : . : . : . :
JMSF047A24+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMSF032F15+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFF044P22+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMSF031O17+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS042F06+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS169E10+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS097A05+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS084A02+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMSF024I11+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFF039K23+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMSF041I08+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMSF024M05+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS097A10+ CGTCTATGGGGCCGCCTCAAGGGGGATCAAGCGTCCCTGTTGCGCGTTAGGTCTCACGTG
JMFF034O22+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFF046N14+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMSF001K06+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS025D01+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
JMFS009E11+ CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
                      ____________________________________________________________
consensus CGGCGATGGGGCCGCC-GAAGGGGGAACAAGCGACCTTGTTGCGCGTTAGGTC-CACGTG
 
. : . : . : . : . : . :
JMSF047A24+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMSF032F15+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFF044P22+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMSF031O17+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS042F06+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS169E10+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS097A05+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS084A02+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMSF024I11+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFF039K23+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMSF041I08+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMSF024M05+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS097A10+ CTTCCAATGCATATTATAGAGCTCCGGCTTCCTGTAATGCCGCTTATAGAGGAGCCTGCC
JMFF034O22+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFF046N14+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMSF001K06+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS025D01+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
JMFS009E11+ CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
                      ____________________________________________________________
consensus CTTCCATTGCATCTGATAGAGCTCCGGCTTCCTGTAATACCGATTATAGAGAAG-CTGCC
 
. : . : . : . : . : . :
JMSF047A24+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMSF032F15+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFF044P22+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMSF031O17+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFS042F06+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-C
JMFS169E10+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGT
JMFS097A05+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGA
JMFS084A02+ ATTCAGCAGCCACTGATACTGTGCTCATCCTT
JMSF024I11+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFF039K23+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMSF041I08+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMSF024M05+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFS097A10+ ATTCAGCAGCCAATGATCCTGTGCTCATCCCTAGGTTGCTACTGGGACGGTGCGCCGGA
JMFF034O22+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFF046N14+ ATTCAGCAGCCACTGATACTGTGCTCATCCTT
JMSF001K06+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFS025D01+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
JMFS009E11+ ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
                      ____________________________________________________________
consensus ATTCAGCAGCCACTGATACTGTGCTCATCCTTAGATTGTTACT-CGACGGTGCGCCGGAC
 
. : . : . : . : . : . :
JMSF047A24+ TGGATAATCC
JMSF032F15+ TGGATAATCCG
JMFF044P22+ TGGATAATCC
JMSF031O17+ TGGATAATCCGCGCTC
JMSF024I11+ TGGATAA
JMFF039K23+ TGGATAATCC
JMSF041I08+ TGGATAATCCGCGCTCGAATGATTGCCAATTTCACGA
JMSF024M05+ TGGATAATCCGCGCTCGAATGATTGCCAATTTCACGACAAGAAGCTTC
JMFF034O22+ T
JMSF001K06+ T
JMFS025D01+ TGGATAATCCGCGCTCGAATGATTGC
JMFS009E11+ TGGATAATCCGCGCTCGAATGATTGCCAATTTCACGACAAGAAGCTTCCGGAGGGTGTTG
                      ____________________________________________________________
consensus TGGATAATCCGCGCTCGAATGATTGCCAATTTCACGACAAGAAGCTTCCGGAGGGTGTTG