Previous Contig 002888:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008G02Sequence624002888 (2)pir|H71439|H714392e-26hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV45_1545514 Arabidopsis tha
JMFS053G01Sequence618002888 (2)pir|H71439|H714391e-32hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV45_1545514 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS053G01+ GCAAATGACCGGTGTTCTGACTCTCGAGAACCGAATACTCCGCTACAA
                      ____________________________________________________________
consensus GCAAATGACCGGTGTTCTGACTCTCGAGAACCGAATACTCCGCTACAA
 
. : . : . : . : . : . :
JMFS053G01+ GAGGAAGATAATTGGTTATCGAGAGTGGAGCCCGAATCACGAGGGTCCAGTCTTGAATGG
                      ____________________________________________________________
consensus GAGGAAGATAATTGGTTATCGAGAGTGGAGCCCGAATCACGAGGGTCCAGTCTTGAATGG
 
. : . : . : . : . : . :
JMFS053G01+ GATCTGAATGAACGTCCTTTGCAATCTCGGTGGCTTGAATACTCAAACAGAACCACCTGC
                      ____________________________________________________________
consensus GATCTGAATGAACGTCCTTTGCAATCTCGGTGGCTTGAATACTCAAACAGAACCACCTGC
 
. : . : . : . : . : . :
JMFS053G01+ CACGTGAACTGCTCGATGTTCCACTAACCAACGAGCAGTACAAGAGTTCCTCGGACTCTT
                      ____________________________________________________________
consensus CACGTGAACTGCTCGATGTTCCACTAACCAACGAGCAGTACAAGAGTTCCTCGGACTCTT
 
. : . : . : . : . : . :
JMFS053G01+ GGAGACTCGAGACACATATCCCCGAGTTTTCTGGTCGCAAACCAACATCATGTGAGTTGC
                      ____________________________________________________________
consensus GGAGACTCGAGACACATATCCCCGAGTTTTCTGGTCGCAAACCAACATCATGTGAGTTGC
 
. : . : . : . : . : . :
JMFS053G01+ GTGTTTTGTCAATAACAGAACTCCATGAATATTCTTCTGCTTCATCCAGATTTGACGGTC
                      ____________________________________________________________
consensus GTGTTTTGTCAATAACAGAACTCCATGAATATTCTTCTGCTTCATCCAGATTTGACGGTC
 
. : . : . : . : . : . :
JMFS053G01+ TAAATTGCAATAAATAGCGTCCAGACTGAGTAACTGCAGAGAGAGGAAGAGGAGTAACTT
                      ____________________________________________________________
consensus TAAATTGCAATAAATAGCGTCCAGACTGAGTAACTGCAGAGAGAGGAAGAGGAGTAACTT
 
. : . : . : . : . : . :
JMFS053G01+ CACCGGGCCTTAGAGGCCCAACACAAAACTGCGGTTTATGATCTCCCAAACCACATCTTC
                      ____________________________________________________________
consensus CACCGGGCCTTAGAGGCCCAACACAAAACTGCGGTTTATGATCTCCCAAACCACATCTTC
 
. : . : . : . : . : . :
JMFS053G01+ TATGACGAACCCACCTCCTCTGTCGTGCATAGTTCACAGACTCGACTGGATTACAAGATT
JMFS008G02+ CAGACTCGACTGGATTACAAGATT
                      ____________________________________________________________
consensus TATGACGAACCCACCTCCTCTGTCGTGCATAGTTCACAGACTCGACTGGATTACAAGATT
 
. : . : . : . : . : . :
JMFS053G01+ CCGGCCACTTCAGACTTTCAACGTTCGGAGCATAAGCCCATCCGTCAGTAATTTTAACAC
JMFS008G02+ CCGGCCACTTCAGACTTTCAACGTTCGGAGCATAAGCCCATCCGTCAGTAATTTTAACAC
                      ____________________________________________________________
consensus CCGGCCACTTCAGACTTTCAACGTTCGGAGCATAAGCCCATCCGTCAGTAATTTTAACAC
 
. : . : . : . : . : . :
JMFS053G01+ AACT
JMFS008G02+ AACTGTTATCAACATGCCATTCATCAACCCATTCCCACCCTGATGGCAACCCAACTCCAG
                      ____________________________________________________________
consensus AACTGTTATCAACATGCCATTCATCAACCCATTCCCACCCTGATGGCAACCCAACTCCAG
 
. : . : . : . : . : . :
JMFS008G02+ AAGCCATCTCATTGAAATCCGATCCAACCCAGCCAGCAGTAGGTGTATATTTCTGAGTTT
                      ____________________________________________________________
consensus AAGCCATCTCATTGAAATCCGATCCAACCCAGCCAGCAGTAGGTGTATATTTCTGAGTTT
 
. : . : . : . : . : . :
JMFS008G02+ CAAACAACTCGCAAGGAACGAATTCATAGCCATTATCGTTTTCTTCCTTCCTTTCATTAT
                      ____________________________________________________________
consensus CAAACAACTCGCAAGGAACGAATTCATAGCCATTATCGTTTTCTTCCTTCCTTTCATTAT
 
. : . : . : . : . : . :
JMFS008G02+ CCGGAGCCATTGTTTCATCTGAAGTTCTCAGTTTCAACAGCAGATGCATTGTAAATTCAG
                      ____________________________________________________________
consensus CCGGAGCCATTGTTTCATCTGAAGTTCTCAGTTTCAACAGCAGATGCATTGTAAATTCAG
 
. : . : . : . : . : . :
JMFS008G02+ TATCATTACGGACTGAAACCAGGGATCTTATATTCACGTATCGGTTATTTTCCATTATGG
                      ____________________________________________________________
consensus TATCATTACGGACTGAAACCAGGGATCTTATATTCACGTATCGGTTATTTTCCATTATGG
 
. : . : . : . : . : . :
JMFS008G02+ TTACTTCACTGGCAACAACGTTGTTGCCTAACCGCCAACAGGCAGCAGGTGCAGCGTAGT
                      ____________________________________________________________
consensus TTACTTCACTGGCAACAACGTTGTTGCCTAACCGCCAACAGGCAGCAGGTGCAGCGTAGT
 
. : . : . : . : . : . :
JMFS008G02+ TTAGCTTCACTGTAGTCCACGGCCCTTCCCTCGTGGGACTAATCTGAATAACGCCCACTT
                      ____________________________________________________________
consensus TTAGCTTCACTGTAGTCCACGGCCCTTCCCTCGTGGGACTAATCTGAATAACGCCCACTT
 
. : . : . : . : . : . :
JMFS008G02+ TTTTCCCCTTGTCAGATGATCTCTTGCTGATTTCCGTATCCATTCGAGGGGACAAGTAAC
                      ____________________________________________________________
consensus TTTTCCCCTTGTCAGATGATCTCTTGCTGATTTCCGTATCCATTCGAGGGGACAAGTAAC
 
. : . : . : . : . : . :
JMFS008G02+ ACCCACACTTTATTCTCCCGGCTGATTTCATTACTCTTTCTTCTCCAGATGCCATCGCGG
                      ____________________________________________________________
consensus ACCCACACTTTATTCTCCCGGCTGATTTCATTACTCTTTCTTCTCCAGATGCCATCGCGG