Previous Contig 002883:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008A03Sequence631002883 (2)gb:AK118775_18167374e-83Arabidopsis thaliana At4g21320 mRNA for unknown protein, complete cds, clone: RA
JMSF033J09Sequence651002883 (2)gb:AK118775_18167372e-82Arabidopsis thaliana At4g21320 mRNA for unknown protein, complete cds, clone: RA687011805 (2)pir|T05748|T057488e-66hypothetical protein M4I22.50 - Arabidopsis thaliana>gb:ATCHRIV66_1546605 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033J09+ CGGAC
                      ____________________________________________________________
consensus CGGAC
 
. : . : . : . : . : . :
JMSF033J09+ AGAATCAGCATGCCTGCATAAGTCATCTGCATCAATCATTATCATGTCTGCCCCTGCTTC
JMFS008A03+ CATCAATCATTATCATGTCTGCCCCTGCTTC
                      ____________________________________________________________
consensus AGAATCAGCATGCCTGCATAAGTCATCTGCATCAATCATTATCATGTCTGCCCCTGCTTC
 
. : . : . : . : . : . :
JMSF033J09+ TAAGCATCTCTCTGCCCTCCTAACCAAGAGGTCCACATCTTCCACAAAGTCTGAACTTCG
JMFS008A03+ TAAGCATCTCTCTGCCCTCCTAACCAAGAGGTCCACATCTTCCACAAAGTCTGAACTTCG
                      ____________________________________________________________
consensus TAAGCATCTCTCTGCCCTCCTAACCAAGAGGTCCACATCTTCCACAAAGTCTGAACTTCG
 
. : . : . : . : . : . :
JMSF033J09+ AGGCGCTGGAACAACATAAGCTCCAAAAGCTCTATTGCTGCTCAAGGGCACATCAGACTT
JMFS008A03+ AGGCGCTGGAACAACATAAGCTCCAAAAGCTCTATTGCTGCTCAAGGGCACATCAGACTT
                      ____________________________________________________________
consensus AGGCGCTGGAACAACATAAGCTCCAAAAGCTCTATTGCTGCTCAAGGGCACATCAGACTT
 
. : . : . : . : . : . :
JMSF033J09+ GTTAAACTTGACTGAAAACTGAGGCTTAACTCGAAGACCATCACTCTTAATCAACCGCAC
JMFS008A03+ GTTAAACTTGACTGAAAACTGAGGCTTAACTCGAAGACCATCACTCTTAATCAACCGCAC
                      ____________________________________________________________
consensus GTTAAACTTGACTGAAAACTGAGGCTTAACTCGAAGACCATCACTCTTAATCAACCGCAC
 
. : . : . : . : . : . :
JMSF033J09+ ATATCTTAAAAGAGTCTCCTCAGGAATATCTAATGATGTAACATCGAGTTCAATGGTATC
JMFS008A03+ ATATCTTAAAAGAGTCTCCTCAGGAATATCTAATGATGTAACATCGAGTTCAATGGTATC
                      ____________________________________________________________
consensus ATATCTTAAAAGAGTCTCCTCAGGAATATCTAATGATGTAACATCGAGTTCAATGGTATC
 
. : . : . : . : . : . :
JMSF033J09+ AAACCCCAACTGCTTATATTCCTCGATGTATTCTTTAAGATGTGAAGGACCTTTGCGAAG
JMFS008A03+ AAACCCCAACTGCTTATATTCCTCGATGTATTCTTTAAGATGTGAAGGACCTTTGCGAAG
                      ____________________________________________________________
consensus AAACCCCAACTGCTTATATTCCTCGATGTATTCTTTAAGATGTGAAGGACCTTTGCGAAG
 
. : . : . : . : . : . :
JMSF033J09+ CAAGTTTTCAGCACAATCACCACTGCTAACATATACATTGTGTTTATGTGCCATGTCAAT
JMFS008A03+ CAAGTTTTCAGCACAATCACCACTGCTAACATACACATTGTGTTTATGTGCCATGTCAAT
                      ____________________________________________________________
consensus CAAGTTTTCAGCACAATCACCACTGCTAACATATACATTGTGTTTATGTGCCATGTCAAT
 
. : . : . : . : . : . :
JMSF033J09+ TACGTCTCTGATGTATGTCTTTGGCATCATACTGTGAGATCCTCCACTAAACTTCAGCCC
JMFS008A03+ TACGTCTCTGATGTATGTCTTTGGCATCATACTGTGAGATCCTCCACTAAACTTCAGCCC
                      ____________________________________________________________
consensus TACGTCTCTGATGTATGTCTTTGGCATCATACTGTGAGATCCTCCACTAAACTTCAGCCC
 
. : . : . : . : . : . :
JMSF033J09+ ATCAACAAACTGCCCCATAGACTCAAAAATATCCTGGAGGAGGGGGCGGGAGAAGAGAGA
JMFS008A03+ ATCAACAAACTGCCCCATAGACTCAAAAATATCCTGGAGGAGGGGGCGGGAGAAGAGAGA
                      ____________________________________________________________
consensus ATCAACAAACTGCCCCATAGACTCAAAAATATCCTGGAGGAGGGGGCGGGAGAAGAGAGA
 
. : . : . : . : . : . :
JMSF033J09+ GTAATGCGGAGACCTCATTTCGGTGACGCCATAACTCCTTGGCTTTTCCGGCCGATCTTC
JMFS008A03+ GTAATGCGGAGACCTCATTTCGGTGACGCCATAACTCCTTGGCTTTTCCGGCCGATCTTC
                      ____________________________________________________________
consensus GTAATGCGGAGACCTCATTTCGGTGACGCCATAACTCCTTGGCTTTTCCGGCCGATCTTC
 
. : . : . : . : . : . :
JMSF033J09+ GTCGTCGTAGAAGCTTTTCCACCTGTACGCTGCCATCGCTCTCT
JMFS008A03+ GTCGTCGTAGAAGCTTTTCCACCTGTACGCTGCCATCGCTCTCTGTCTCCGTTGGTCTCA
                      ____________________________________________________________
consensus GTCGTCGTAGAAGCTTTTCCACCTGTACGCTGCCATCGCTCTCTGTCTCCGTTGGTCTCA