Previous Contig 002879:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS007F08Sequence622002879 (3)gb:AY448010S4_16065883e-61Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMFS046E09Sequence636002879 (3)gb:AY448010S4_16065886e-71Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMSF018C09Sequence216002879 (3)716022811gb:AY448010S4_16065885e-26Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS046E09+ ATGTTTCCAACC
                      ____________________________________________________________
consensus ATGTTTCCAACC
 
. : . : . : . : . : . :
JMFS046E09+ AATGTTAGTGCTAGACACTGAAATGTCTCATTGCGTCCAATTATGTCATTCCGCACAGTA
JMFS007F08+ AATTATGTCATTCCGCACAGTA
                      ____________________________________________________________
consensus AATGTTAGTGCTAGACACTGAAATGTCTCATTGCGTCCAATTATGTCATTCCGCACAGTA
 
. : . : . : . : . : . :
JMFS046E09+ TTAATTGCTAATCGCAAGAAGTCATGATTCTCATTGAGCAAACATGATGTGACTATGTAA
JMFS007F08+ TTAATTGCTAATCGCAAGAAGTCATGATTCTCATTGAGCAAACATGATGTGACTATGTAA
                      ____________________________________________________________
consensus TTAATTGCTAATCGCAAGAAGTCATGATTCTCATTGAGCAAACATGATGTGACTATGTAA
 
. : . : . : . : . : . :
JMFS046E09+ CCAACCTGCTTCTCAGGATACTTCGGAGCAGATATTAGAGAAACAGCTTCCATATGACCA
JMFS007F08+ CCAACCTGCTTCTCAGGATACTTCGGAGCAGATATTAGAGAAACAGCTTCCATATGACCA
                      ____________________________________________________________
consensus CCAACCTGCTTCTCAGGATACTTCGGAGCAGATATTAGAGAAACAGCTTCCATATGACCA
 
. : . : . : . : . : . :
JMFS046E09+ AAATCCACATCATAACCAAGCATAAATATGTAAAGCATTTTCCAAACATATTTCTTTTTC
JMFS007F08+ AAATCCACATCATAACCAAGCATAAATATGTAAAGCATTTTCCAAACATATTTCTTTTTC
                      ____________________________________________________________
consensus AAATCCACATCATAACCAAGCATAAATATGTAAAGCATTTTCCAAACATATTTCTTTTTC
 
. : . : . : . : . : . :
JMFS046E09+ TCATAAGGTGTCAAACCCTTTTCGTTCTTGAATCGAGTACGGATATTCCCGAGCTCCTTG
JMFS007F08+ TCATAAGGTGTCAAACCCTTTTCGTTCTTGAATCGAGTACGGATATTCCCGAGCTCCTTG
                      ____________________________________________________________
consensus TCATAAGGTGTCAAACCCTTTTCGTTCTTGAATCGAGTACGGATATTCCCGAGCTCCTTG
 
. : . : . : . : . : . :
JMFS046E09+ TCGACGCGGAGACGCTCCTGCTCTTTGTTCTGGCAATTGCGAATGTCGCTTATGAACACC
JMFS007F08+ TCGACGCGGAGACGCTCCTGCTCTTTGTTCTGGCAATTGCGAATGTCGCTTATGAACACC
                      ____________________________________________________________
consensus TCGACGCGGAGACGCTCCTGCTCTTTGTTCTGGCAATTGCGAATGTCGCTTATGAACACC
 
. : . : . : . : . : . :
JMFS046E09+ GACAGACCCCTCATGCCAGACAACGCCATCTCCCCCGGACGCTCAGATCCGATCCAGCTC
JMFS007F08+ GACAGACCCCTCATGCCAGACAACGCCATCTCCCCCGGACGCTCAGATCCGATCCAGCTC
                      ____________________________________________________________
consensus GACAGACCCCTCATGCCAGACAACGCCATCTCCCCCGGACGCTCAGATCCGATCCAGCTC
 
. : . : . : . : . : . :
JMFS046E09+ AGAGGCGGCTCCCAATTTCTTCTCGATCCAACGTTTCCACAAAGGTCTTCCCTTCAAAGA
JMSF018C09+ TCTTCTCGATCCAACGTTTCCACAAAGGTCTTCCCTTCAAAGA
JMFS007F08+ AGAGGCGGCTCCCAATTTCTTCTCGATCCAACGTTTCCACAAAGGTCTTCCCTTCAAAGA
                      ____________________________________________________________
consensus AGAGGCGGCTCCCAATTTCTTCTCGATCCAACGTTTCCACAAAGGTCTTCCCTTCAAAGA
 
. : . : . : . : . : . :
JMFS046E09+ TCGAGCCTCCAAACTCACATAAAAATGCGCTTCTGTCAATTCGTCTCCCAGTGTAAAAAC
JMSF018C09+ TCGAGCCTCCAAACTCACATAAAAATGCGCTTCTGTCAATTCGTCTCCCAGTGTAAAAAC
JMFS007F08+ TCGAGCCTCCAAACTCACATAAAAATGCGCTTCTGTCAATTCGTCTCCCAGTGTAAAAAC
                      ____________________________________________________________
consensus TCGAGCCTCCAAACTCACATAAAAATGCGCTTCTGTCAATTCGTCTCCCAGTGTAAAAAC
 
. : . : . : . : . : . :
JMFS046E09+ GCGCGTATGTATCTTCTGTATGGATAGATAGAGAGAGAAAAGAAGAGGGAATAGAGAAAG
JMSF018C09+ GCGCGTATGTATCTTCTGTATGGATAGATAGAGAGAGAAAAGAAGAGGGAATAGAGAAAG
JMFS007F08+ GCGCGTATGTATCTTCTGTATGGATAGATAGAGAGAGAAAAGAAGAGGGAATAGAGAAAG
                      ____________________________________________________________
consensus GCGCGTATGTATCTTCTGTATGGATAGATAGAGAGAGAAAAGAAGAGGGAATAGAGAAAG
 
. : . : . : . : . : . :
JMFS046E09+ TGTATTGTGATCTAGAGAGAGAAA
JMSF018C09+ TGTATTGTGATCTAGAGAGAGAAAGGTGGACTGAGAAAAATTGGAGCAGCC
JMFS007F08+ TGTATTGTGATCTAGAGAGAGAAAGGTGGACTGAGAAAAATTGGAGCAGCCGTCGGGCCA
                      ____________________________________________________________
consensus TGTATTGTGATCTAGAGAGAGAAAGGTGGACTGAGAAAAATTGGAGCAGCCGTCGGGCCA