Previous Contig 002877:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS007C04Sequence448002877 (2)
JMFS139H05Sequence599002877 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS139H05+ TGAATTTAACAAATGACCCACCTATAATCTGAAAATAAAAAATCCACACCAATAACTTAT
                      ____________________________________________________________
consensus TGAATTTAACAAATGACCCACCTATAATCTGAAAATAAAAAATCCACACCAATAACTTAT
 
. : . : . : . : . : . :
JMFS139H05+ CAGGATTAGAACCTAACTCTTAAAAAAATGCCCTCTTTAATGCAAACACCACTTGAAGGC
                      ____________________________________________________________
consensus CAGGATTAGAACCTAACTCTTAAAAAAATGCCCTCTTTAATGCAAACACCACTTGAAGGC
 
. : . : . : . : . : . :
JMFS139H05+ TAGACACACTTATTTCAGAAATTGTACATTCTAAGTCAAAACAATATTTCAGAACTCAAT
JMFS007C04+ AAGTCAAAACAATATTTCAGAACTCAAT
                      ____________________________________________________________
consensus TAGACACACTTATTTCAGAAATTGTACATTCTAAGTCAAAACAATATTTCAGAACTCAAT
 
. : . : . : . : . : . :
JMFS139H05+ ATATCAAAACCGACAAATATATGATAGACACACTTGAAGGCTAGACAGAGCAATCAGAGA
JMFS007C04+ ATATCAAAACCGACAAATATATGATAGACACACTTGAAGGCTAGACAGAGCAATCAGAGA
                      ____________________________________________________________
consensus ATATCAAAACCGACAAATATATGATAGACACACTTGAAGGCTAGACAGAGCAATCAGAGA
 
. : . : . : . : . : . :
JMFS139H05+ ACTTTGAAAGCCAATAATCTGAGTTATTTCCACACTGAGAAATTCAGCTCATTTATGATC
JMFS007C04+ ACTTTGAAAGCCAATAATCTGAGTTATTTCCACACTGAGAAATTCAGCTCATTTATGATC
                      ____________________________________________________________
consensus ACTTTGAAAGCCAATAATCTGAGTTATTTCCACACTGAGAAATTCAGCTCATTTATGATC
 
. : . : . : . : . : . :
JMFS139H05+ TCATCACTTTGCTTAACCCAGAAATTCAACAGCAACTTCACAAATACTCGTTAAAAAGAA
JMFS007C04+ TCATCACTTTGCTTAACCCAGAAATTCAACAGCAACTTCACAAATACTCGTTAAAAAGAA
                      ____________________________________________________________
consensus TCATCACTTTGCTTAACCCAGAAATTCAACAGCAACTTCACAAATACTCGTTAAAAAGAA
 
. : . : . : . : . : . :
JMFS139H05+ TTCAAAGTTGATAGCTACTTCACAAAAGCTGTTTACTTTGACAGATCAAAACTGAACAAG
JMFS007C04+ TTCAAAGTTGATAGCTACTTCACAAAAGCTGTTTACTTTGACAGATCAAAACTGAACAAG
                      ____________________________________________________________
consensus TTCAAAGTTGATAGCTACTTCACAAAAGCTGTTTACTTTGACAGATCAAAACTGAACAAG
 
. : . : . : . : . : . :
JMFS139H05+ AATCTACAAGCCAGCCCAAAGATCTGCCAAGTACTGTACATTTTGCACCTTTACCTTTAC
JMFS007C04+ AATCTACAAGCCAGCCCAAAGATCTGCCAAGTACTGTACATTTTGCACCTTTACCTTTAC
                      ____________________________________________________________
consensus AATCTACAAGCCAGCCCAAAGATCTGCCAAGTACTGTACATTTTGCACCTTTACCTTTAC
 
. : . : . : . : . : . :
JMFS139H05+ TCGAACTTTCTTTACAACCACGAACTCAAAGTTGCAAAGGGCTATTTGGTGCACTAAAAC
JMFS007C04+ TCGAACTTTCTTTACAACCACGAACTCAAAGTTGCAAAGGGCTATTTGGTGCACTAAAAC
                      ____________________________________________________________
consensus TCGAACTTTCTTTACAACCACGAACTCAAAGTTGCAAAGGGCTATTTGGTGCACTAAAAC
 
. : . : . : . : . : . :
JMFS139H05+ AGCAACTAAATGTAAACACAGAAAACATGCATTACCAGATCGCAGAAAGGAGCGTTGTG
JMFS007C04+ AGCAACTAAATGTAAACACAGAAAACATGCATTACCAGATCGCAGAAAGGAGCGTTGTGA
                      ____________________________________________________________
consensus AGCAACTAAATGTAAACACAGAAAACATGCATTACCAGATCGCAGAAAGGAGCGTTGTGA