Previous Contig 002874:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003H15Sequence560002874 (6)gb:AK176406_18183945e-50Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-12-B21.>gb:AK176479_18184670020703
JMFS006H03Sequence561002874 (6)gb:AK176406_18183942e-49Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-12-B21.>gb:AK176479_18184
JMFS017A01Sequence618002874 (6)gb:AK176406_18183945e-77Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-12-B21.>gb:AK176479_18184
JMFS033G04Sequence576002874 (6)gb:AK176406_18183943e-30Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-12-B21.>gb:AK176479_18184
JMFS068D03Sequence618002874 (6)gb:AK176406_18183942e-69Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-12-B21.>gb:AK176479_18184
JMFS135E03Sequence650002874 (6)gb:AK176406_18183947e-37Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-12-B21.>gb:AK176479_18184

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS033G04+ ATATGTGT
                      ____________________________________________________________
consensus ATATGTGT
 
. : . : . : . : . : . :
JMFS033G04+ AGGACTCTGTGCAGCACCAACGGCCTCCTCATAACTAGGAGGAGCACCAAGATTTTGCTC
                      ____________________________________________________________
consensus AGGACTCTGTGCAGCACCAACGGCCTCCTCATAACTAGGAGGAGCACCAAGATTTTGCTC
 
. : . : . : . : . : . :
JMFS033G04+ AGAGTATTTCTGATCAATCCTACCATGAGAAGCACTTCCTTGTGACTGATCCTCAGCCCT
                      ____________________________________________________________
consensus AGAGTATTTCTGATCAATCCTACCATGAGAAGCACTTCCTTGTGACTGATCCTCAGCCCT
 
. : . : . : . : . : . :
JMFS033G04+ GCCACCACTTTCTCTGGAGGAGTATTGACCATCATCATCATAAGCATGATCTCTCTCTTT
                      ____________________________________________________________
consensus GCCACCACTTTCTCTGGAGGAGTATTGACCATCATCATCATAAGCATGATCTCTCTCTTT
 
. : . : . : . : . : . :
JMFS033G04+ CTCAGAACTTCTTGAACCAGAGTTATATTCATCAATGTTCCGATTTCTTCCACTATAATC
                      ____________________________________________________________
consensus CTCAGAACTTCTTGAACCAGAGTTATATTCATCAATGTTCCGATTTCTTCCACTATAATC
 
. : . : . : . : . : . :
JMFS033G04+ ATCATCCCTATATCCATCACGGGTGTAACGCTCATCATACTCTCTACCATAGCGATCCCC
                      ____________________________________________________________
consensus ATCATCCCTATATCCATCACGGGTGTAACGCTCATCATACTCTCTACCATAGCGATCCCC
 
. : . : . : . : . : . :
JMFS033G04+ TTCACGGCCATATGAATCCCTGCCATATCTGTCTTCATTACCACCCCATTCTCTCTCTCT
JMFS017A01+ ATCCCTGCCATATCTGTCTTCATTACCACNCCATTCTCTCTCTCT
                      ____________________________________________________________
consensus TTCACGGCCATATGAATCCCTGCCATATCTGTCTTCATTACCACCCCATTCTCTCTCTCT
 
. : . : . : . : . : . :
JMFS033G04+ CCCATAACCATTTCTATCATCATCCCTGCCCCCATAACGATCTTCATCATATCTGTCACC
JMFS017A01+ CCCATAACCATTTCTATCATCATCCCTGCCCCCATAACGATCTTCATCATATCTGTCACC
                      ____________________________________________________________
consensus CCCATAACCATTTCTATCATCATCCCTGCCCCCATAACGATCTTCATCATATCTGTCACC
 
. : . : . : . : . : . :
JMFS033G04+ ATACCCCCCTGTGTTTGAATATGAACCAGGCCGATACATACTGCCCGTTGATGTGTTCCG
JMFS017A01+ ATACCCCCCTGTGTTTGAATATGAACCAGGCCGATACATACTGCCCGTTGATGTGTTCCG
                      ____________________________________________________________
consensus ATACCCCCCTGTGTTTGAATATGAACCAGGCCGATACATACTGCCCGTTGATGTGTTCCG
 
. : . : . : . : . : . :
JMFS033G04+ ATATTTGTCCCTGTTTGCAGCAGCCTTTTGACGAACTTCTTGTATTCTTTCCTTGTCATT
JMFS017A01+ ATATTTGTCCCTGTTTGCAGCAGCCTTTTGACGAACTTCTTGTATTCTTTCCTTGTCATT
                      ____________________________________________________________
consensus ATATTTGTCCCTGTTTGCAGCAGCCTTTTGACGAACTTCTTGTATTCTTTCCTTGTCATT
 
. : . : . : . : . : . :
JMFS033G04+ CACTAAAGCGACAAGACTCTGAGATTTC
JMFS017A01+ CACTAAAGCGACAAGACTCTGAGATTTCTTTCTTACATTGCTTCCCTGATCTCTTCCACT
                      ____________________________________________________________
consensus CACTAAAGCGACAAGACTCTGAGATTTCTTTCTTACATTGCTTCCCTGATCTCTTCCACT
 
. : . : . : . : . : . :
JMFS017A01+ TGAATCAACATATTGAAACTCAGACAATGTTGTGATCTGGTATGAGTGTTCCCTGATTTC
JMFF003H15+ GTATGAGTGTTCCCTGATTTC
JMFS006H03+ GTATGAGTGTTCCCTGATTTC
                      ____________________________________________________________
consensus TGAATCAACATATTGAAACTCAGACAATGTTGTGATCTGGTATGAGTGTTCCCTGATTTC
 
. : . : . : . : . : . :
JMFS017A01+ ATCAATGACACGTTCTGATCCATGGGCAACCAAGTATTCCAAAACAGTTAAAGCCTTGTA
JMFS068D03+ CCTTGTA
JMFS135E03+ CCTTGTA
JMFF003H15+ ATCAATGACACGTTCTGATCCATGGGCAACCAAGTATTCCAAAACAGTTAAAGCCTTGTA
JMFS006H03+ ATCAATGACACGTTCTGATCCATGGGCAACCAAGTATTCCAAAACAGTTAAAGCCTTGTA
                      ____________________________________________________________
consensus ATCAATGACACGTTCTGATCCATGGGCAACCAAGTATTCCAAAACAGTTAAAGCCTTGTA
 
. : . : . : . : . : . :
JMFS017A01+ AACATGCCGCCAATTTTTCCCAGTGTCATTGAGGCGCTTCCAAATTACAGTCATAATCAT
JMFS068D03+ AACATGCCGCCAATTTTTCCCAGTGTCATTGAGGCGCTTCCAAATTACAGTCATAATCAT
JMFS135E03+ AACATGCCGCCAATTTTTCCCAGTGTCATTGAGGCGCTTCCAAATTACAGTCATAATCAT
JMFF003H15+ AACATGCCGCCAATTTTTCCCAGTGTCATTGAGGCGCTTCCAAATTACAGTCATAATCAT
JMFS006H03+ AACATGCCGCCAATTTTTCCCAGTGTCATTGAGGCGCTTCCAAATTACAGTCATAATCAT
                      ____________________________________________________________
consensus AACATGCCGCCAATTTTTCCCAGTGTCATTGAGGCGCTTCCAAATTACAGTCATAATCAT
 
. : . : . : . : . : . :
JMFS017A01+ TTGGTATTCATTGTAGTTTCTTGAAGCTTGTGCAATATCAGCAAGATGTGATCCATGAGG
JMFS068D03+ TTGGTATTCATTGTAGTTTCTTGAAGCTTGTGCAATATCAGCAAGATGTGATCCATGAGG
JMFS135E03+ TTGGTATTCATTGTAGTTTCTTGAAGCTTGTGCAATATCAGCAAGATGTGATCCATGAGG
JMFF003H15+ TTGGTATTCATTGTAGTTTCTTGAAGCTTGTGCAATATCAGCAAGATGTGATCCATGAGG
JMFS006H03+ TTGGTATTCATTGTAGTTTCTTGAAGCTTGTGCAATATCAGCAAGATGTGATCCATGAGG
                      ____________________________________________________________
consensus TTGGTATTCATTGTAGTTTCTTGAAGCTTGTGCAATATCAGCAAGATGTGATCCATGAGG
 
. : . : . : . : . : . :
JMFS017A01+ ACCCCATGGCTCATTGCTAGTAGCATCAAGCACTTTTTGTTCTACTGAAGGGACTTTAAG
JMFS068D03+ ACCCCATGGCTCATTGCTAGTAGCATCAAGCACTTTTTGTTCTACTGAAGGGACTTTAAG
JMFS135E03+ ACCCCATGGCTCATTGCTAGTAGCATCAAGCACTTTTTGTTCTACTGAAGGGACTTTAAG
JMFF003H15+ ACCCCATGGCTCATTGCTAGTAGCATCAAGCACTTTTTGTTCTACTGAAGGGACTTTAAG
JMFS006H03+ ACCCCATGGCTCATTGCTAGTAGCATCAAGCACTTTTTGTTCTACTGAAGGGACTTTAAG
                      ____________________________________________________________
consensus ACCCCATGGCTCATTGCTAGTAGCATCAAGCACTTTTTGTTCTACTGAAGGGACTTTAAG
 
. : . : . : . : . : . :
JMFS017A01+ AACTTTCTTGTTAACACCCCGCTTTAAGTCTCG
JMFS068D03+ AACTTTCTTGTTAACACCCCGCTTTAAGTCTCGCACAGTTTGATCAAAGACCTTCTTCAT
JMFS135E03+ AACTTTCTTGTTAACACCCCGCTTTAAGTCTCGCACAGTTTGATCAAAGACCTTCTTCAT
JMFF003H15+ AACTTTCTTGTTAACACCCCGCTTTAAGTCTCGCACAGTTTGATCAAAGACCTTCTTCAT
JMFS006H03+ AACTTTCTTGTTAACACCCCGCTTTAAGTCTCGCACAGTTTGATCAAAGACCTTCTTCAT
                      ____________________________________________________________
consensus AACTTTCTTGTTAACACCCCGCTTTAAGTCTCGCACAGTTTGATCAAAGACCTTCTTCAT
 
. : . : . : . : . : . :
JMFS068D03+ TCTGACCTTATATTATCTGGTCAGTGGTCACTCCCAAAGAAGATCCCTTTAAATAATGTG
JMFS135E03+ TCTGACCTTATATTATCTGGTCAGTGGTCACTCCCAAAGAAGATCCCTTTAAATAATGTG
JMFF003H15+ TCTGACCTTATATTATCTGGTCAGTGGTCACTCCCAAAGAAGATCCCTTTAAATAATGTG
JMFS006H03+ TCTGACCTTATATTATCTGGTCAGTGGTCACTCCCAAAGAAGATCCCTTTAAATAATGTG
                      ____________________________________________________________
consensus TCTGACCTTATATTATCTGGTCAGTGGTCACTCCCAAAGAAGATCCCTTTAAATAATGTG
 
. : . : . : . : . : . :
JMFS068D03+ CTACTGATCGGGCGTCGAACCCTACCCTCCGATATCAGATCTGATCTGATGCGAAAGAGG
JMFS135E03+ CTACTGATCGGGCGTCGAACCCTACCCTCCGATATCAGATCTGATCTGATGCGAAAGAGG
JMFF003H15+ CTACTGATCGGGCGTCGAACCCTACCCTCCGATATCAGATCTGATCTGATGCGAAAGAGG
JMFS006H03+ CTACTGATCGGGCGTCGAACCCTACCCTCCGATATCAGATCTGATCTGATGCGAAAGAGG
                      ____________________________________________________________
consensus CTACTGATCGGGCGTCGAACCCTACCCTCCGATATCAGATCTGATCTGATGCGAAAGAGG
 
. : . : . : . : . : . :
JMFS068D03+ GAGAGAGCGCAAAACGCGAAATGCGTCTTAAAAATTCCTTGCTGCAAA
JMFS135E03+ GAGAGAGCGCAAAACGCGAAATGCGTCTT-AAAATTCCTTGCTGCAAA
JMFF003H15+ GAGAGAGCGCAAAACGCGAAATGCGTCTTAAAAATTCCTTGCTGCAAACAATTGAGAGCT
JMFS006H03+ GAGAGAGCGCAAAACGCGAAATGCGTCTTAAAAATTCCTTGCTGCAAACAATTGAGAGCT
                      ____________________________________________________________
consensus GAGAGAGCGCAAAACGCGAAATGCGTCTTAAAAATTCCTTGCTGCAAACAATTGAGAGCT
 
. : . : . : . : . : . :
JMFF003H15+ GTCTTTTGTTGATCTTTAAAATGAAAATTTATGAGAGAGAAAGCGAGAAGGAGC
JMFS006H03+ GTCTTTTGTTGATCTTTAAAATGAAAATTTATGAGAGAGAAAGCGAGAAGGAGCAAAAGA
                      ____________________________________________________________
consensus GTCTTTTGTTGATCTTTAAAATGAAAATTTATGAGAGAGAAAGCGAGAAGGAGCAAAAGA