Previous Contig 002871:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021B03Sequence646002871 (5)gb:AP004300_18397984e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047
JMFS006E12Sequence499002871 (5)gb:BT004102_16372053e-04Arabidopsis thaliana clone RAFL15-33-F24 (R20971) putative arginine methyltransf
JMSF002M02Sequence366004444 (2)708002871 (5)gb:AP004300_18397988e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047
JMSF043I09Sequence805006612 (5)gb:AY088240_15732611e-38Arabidopsis thaliana clone 4642 mRNA, complete sequence.763002871 (5)gb:AP004300_18397981e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047
JMSF051L08Sequence724004444 (2)gb:BT015414_16422422e-35Arabidopsis thaliana At3g06930 gene, complete cds.623002871 (5)gb:AP004300_18397986e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002M02+ TATATGAAATT-GATA
rJMSF043I09+ TCTCATGTGATAAAACTTTGGCTTCAATTAAGAAGAACTATATGAAATTNGATA
                      ____________________________________________________________
consensus TCTCATGTGATAAAACTTTGGCTTCAATTAAGAAGAACTATATGAAATTNGATA
 
. : . : . : . : . : . :
rJMSF002M02+ TTCCACTTAAATTCATATNTTCTGTAAGCACTAGGATCCATGGACTAGCTTGTTGG-TTG
rJMFF021B03+ GGACTAGCTTGTTGGTTTG
rJMSF051L08+ GGACTAGCTTGNTGGTTTG
rJMSF043I09+ TTCCACTTAAATTCATATCTTCTGTAAGCACTAGGATCCATGGACTAGCTTGTTGGTTTG
                      ____________________________________________________________
consensus TTCCACTTAAATTCATATCTTCTGTAAGCACTAGGATCCATGGACTAGCTTGTTGGTTTG
 
. : . : . : . : . : . :
rJMSF002M02+ ATGTGTTGTTT-AACGGGAGCACTGTTCAGAGGTGGTTGACCACTGCTCCTGGTGCACCC
rJMFF021B03+ ATGTGTTGTTT-AACGGGAGCACTGTTCAGAGGTGGTTGACCACTGCTCCTGGTGCACCC
rJMSF051L08+ ATGTGTTGTTTNAACGGGAGCACTGTTCAGAGGTGGTTGACCACTGCTCCTGGTGCACCC
rJMSF043I09+ ATGTGTTGTTT-AACGGGAGCACTGTTCAGAGGTGGTTGACCACTGCTCCTGGTGCACCC
                      ____________________________________________________________
consensus ATGTGTTGTTT-AACGGGAGCACTGTTCAGAGGTGGTTGACCACTGCTCCTGGTGCACCC
 
. : . : . : . : . : . :
rJMSF002M02+ ACAA-CCCATTGGTACCAGCTACGATGTGTTCTGTCTCAACCTCTTTATGTAATGCCAGG
rJMFF021B03+ ACAACCCCATTGGTACCAGCTACGATGTGTTCTGTCTCAACCTCTTTATGTAATGCCAGG
rJMSF051L08+ ACAA-CCCATTGGTACCAGCTACGATGTGTTCTGTCTCAACCTCTTTATGTAATGCCAGG
rJMSF043I09+ ACAA-CCCATTGGTACCAGCTACGATGTGTTCTGTCTCAACCTCTTTATGTAATGCCAGG
                      ____________________________________________________________
consensus ACAA-CCCATTGGTACCAGCTACGATGTGTTCTGTCTCAACCTCTTTATGTAATGCCAGG
 
. : . : . : . : . : . :
rJMSF002M02+ ACAAGAGATAACCGGACGACTTAAACTTGTTGCTCATAAGGCTCAGAGTTACACCATCTA
rJMFF021B03+ ACAAGAGATAACCGGACGACTTAAACTTGTTGCTCATAAGGCTCAGAGTTACACCATCTA
rJMSF051L08+ ACAAGAGATAACCGGACGACTTAAACTTGTTGCTCATAAGGCTCAGAGTTACACCATCTA
rJMSF043I09+ ACAAGAGATAACCGGACGACTTAAACTTGTTGCTCATAAGGCTCAGAGTTACACCATCTA
                      ____________________________________________________________
consensus ACAAGAGATAACCGGACGACTTAAACTTGTTGCTCATAAGGCTCAGAGTTACACCATCTA
 
. : . : . : . : . : . :
rJMSF002M02+ TCTAACATTGTCAGCTCAAGTTGGAGATATGCTTCAAAGTTCAACTGGAAAACTTGATCT
rJMFF021B03+ TCTAACATTGTCAGCTCAAGTTGGAGATATGCTTCAAAGTTCAACTGGAAAACTTGATCT
rJMSF051L08+ TCTAACATTGTCAGCTCAAGTTGGAGATATGCTTCAAAGTTCAACTGGAAAACTTGATCT
rJMSF043I09+ TCTAACATTGTCAGCTCAAGTTGGAGATATGCTTCAAAGTTCAACTGGAAAACTTGATCT
JMFS006E12+ CAACTGGAAAACTTGATCT
                      ____________________________________________________________
consensus TCTAACATTGTCAGCTCAAGTTGGAGATATGCTTCAAAGTTCAACTGGAAAACTTGATCT
 
. : . : . : . : . : . :
rJMSF002M02+ CAAGGAGCCATACTATCGGATGTCCCAGCCACAATCGTATTCTGCTTCACAAGACCAACC
rJMFF021B03+ CAAGGAGCCATACTATCGGATGTCCCAGCCACAATCGTATTCTGCTTCACAAGACCAACC
rJMSF051L08+ CAAGGAGCCATACTATCGGATGTCCCAGCCACAATCGTATTCTGCTTCACAAGACCAACC
rJMSF043I09+ CAAGGAGCCATACTATCGGATGTCCCAGCCACAATCGTATTCTGCTTCACAAGACCAACC
JMFS006E12+ CAAGGAGCCATACTATCGGATGTCCCAGCCACAATCGTATTCTGCTTCACAAGACCAACC
                      ____________________________________________________________
consensus CAAGGAGCCATACTATCGGATGTCCCAGCCACAATCGTATTCTGCTTCACAAGACCAACC
 
. : . : . : . : . : . :
rJMSF002M02+ TAATCAACTATTACAAACACAGGATTCACAAATGCAATCGCGGGACGATGATGATGCCAT
rJMFF021B03+ TAATCAACTATTACAAACACAGGATTCACAAATGCAATCGCGGGACGATGATGATGCCAT
rJMSF051L08+ TAATCAACTATTACAAACACAGGATTCACAAATGCAATCGCGGGACGATGATGATGCCAT
rJMSF043I09+ TAATCAACTATTACAAACACAGGATTCACAAATGCAATCGCGGGACGATGATGATGCCAT
JMFS006E12+ TAATCAACTATTACAAACACAGGATTCACAAATGCAATCGCGGGACGATGATGATGCCAT
                      ____________________________________________________________
consensus TAATCAACTATTACAAACACAGGATTCACAAATGCAATCGCGGGACGATGATGATGCCAT
 
. : . : . : . : . : . :
rJMSF002M02+ ATTGATGCAACAGCTTTCACCTAATTCCAACGCTGATCTACAATCTCTCTAATGCGCGAA
rJMFF021B03+ ATTGATGCAACAGCTTTCACCTAATTCCAACGCTGATCTACAATCTCTCTAATGCGCGAA
rJMSF051L08+ ATTGATGCAACAGCTTTCACCTAATTCCAACGCTGATCTACAATCTCTCTAATGCGCGAA
rJMSF043I09+ ATTGATGCAACAGCTTTCACCTAATTCCAACGCTGATCTACAATCTCTCTAATGCGCGAA
JMFS006E12+ ATTGATGCAACAGCTTTCACCTAATTCCAACGCTGATCTACAATCTCTCTAATGCGCGAA
                      ____________________________________________________________
consensus ATTGATGCAACAGCTTTCACCTAATTCCAACGCTGATCTACAATCTCTCTAATGCGCGAA
 
. : . : . : . : . : . :
rJMSF002M02+ ATAAAAATTGTAGAGATGCACGCACACTTAGTAGACTCGTCGTTTGTACCATTAATTTCG
rJMFF021B03+ ATAAAAATTGTAGAGATGCACGCACACTTAGTAGACTCGTCGTTTGTACCATTAATTTCG
rJMSF051L08+ ATAAAAATTGTAGAGATGCACGCACACTTAGTAGACTCGTCGTTTGTACCATTAATTTCG
rJMSF043I09+ ATAAAAATTGTAGAGATGCACGCACACTTAGTAGACTCGTCGTTTGTACCATTAATTTCG
JMFS006E12+ ATAAAAATTGTAGAGATGCACGCACACTTAGTAGACTCGTCGTTTGTACCATTAATTTCG
                      ____________________________________________________________
consensus ATAAAAATTGTAGAGATGCACGCACACTTAGTAGACTCGTCGTTTGTACCATTAATTTCG
 
. : . : . : . : . : . :
rJMSF002M02+ GTTGCTTGGCTACAAGGTAAAAGAGCATATGGTTGGTTTTAATCCATGCCAAGTTTTGCC
rJMFF021B03+ GTTGCTTGGCTACAAGGTAAAAGAGCATATGGTTGGTTTTAATCCATGCCAAGTTTTGCC
rJMSF051L08+ GTTGCTTGGCTACAAGGTAAAAGAGCATATGGTTGGTTTTAATCCATGCCAAGTTTTGCC
rJMSF043I09+ GTTGCTTGGCTACAAGGTAAAAGAGCATATGGTTGGTTTTAATCCATGCCAAGTTTTGCC
JMFS006E12+ GTTGCTTGGCTACAAGGTAAAAGAGCATATGGTTGGTTTTAATCCATGCCAAGTTTTGCC
                      ____________________________________________________________
consensus GTTGCTTGGCTACAAGGTAAAAGAGCATATGGTTGGTTTTAATCCATGCCAAGTTTTGCC
 
. : . : . : . : . : . :
rJMSF002M02+ CCATCCCCCGTTCATTGTTTGTTGATTGCCAGGTCTTGGCTTCATGTACTATTGAATATT
rJMFF021B03+ CCATCCCCCGTTCATTGTTTGTTGATTGCCAGGTCTTGGCTTCATGTACTATTGAATATT
rJMSF051L08+ CCATCCCCCGTTCATTGTTTGTTGATTGCCAGGTCTTGGCTTCATGTACTATTGAATATT
rJMSF043I09+ CCATCCCCCGTTCATTGTTTGTTGATTGCCAGGTCTTGGCTTCATGTACTATTGAATATT
JMFS006E12+ CCATCCCCCGTTCATTGTTTGTTGATTGCCAGGTCTTGGCTTCATGTACTATTGAATATT
                      ____________________________________________________________
consensus CCATCCCCCGTTCATTGTTTGTTGATTGCCAGGTCTTGGCTTCATGTACTATTGAATATT
 
. : . : . : . : . : . :
rJMSF002M02+ GATCTCACCACCCACGGTGACTAGCAATGTAGAAAT
rJMFF021B03+ GATCTCACCACCCACGGTGACTAGCAAT
rJMSF051L08+ GATC
rJMSF043I09+ GATCTCACCACCCACGGTGACTAGCAATGTAGAAATTTTNTAACTAAAAAA
JMFS006E12+ GATCTCACCACCCACGGTGACTAGCAATGTAGAAATTTTATAACTAAAAAAATTAGTACT
                      ____________________________________________________________
consensus GATCTCACCACCCACGGTGACTAGCAATGTAGAAATTTTATAACTAAAAAAATTAGTACT
 
. : . : . : . : . : . :
JMFS006E12+ ATCAATATTAATGCTTCATTGCAAATAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus ATCAATATTAATGCTTCATTGCAAATAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTC