Previous Contig 002864:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN039B15Sequence625002864 (2)gb:LEU72148_16847564e-48Lycopersicon esculentum plasma membrane H+-ATPase (LHA4) gene, complete cds.
JMFS005C06Sequence575002864 (2)gb:LEU72148_16847565e-59Lycopersicon esculentum plasma membrane H+-ATPase (LHA4) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039B15+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFN039B15+ ATNTAGAAGGATAGATGCCTCTAAAAGTTGGAAAAAGAAAAAGAAAAAAAAATTAAATCT
                      ____________________________________________________________
consensus ATNTAGAAGGATAGATGCCTCTAAAAGTTGGAAAAAGAAAAAGAAAAAAAAATTAAATCT
 
. : . : . : . : . : . :
JMFN039B15+ GCTACATCCATGAGAGAGTCATCTCTCCAAAAGAGTAAAACCAAACCTTATATTGGTTGG
JMFS005C06+ TCCAAAAGAGTAAAACCAAACCTTATATTGGTTGG
                      ____________________________________________________________
consensus GCTACATCCATGAGAGAGTCATCTCTCCAAAAGAGTAAAACCAAACCTTATATTGGTTGG
 
. : . : . : . : . : . :
JMFN039B15+ GTGCAATGAAATTAACTAGAAAGGCAAAAGTAAAACAGACAAACAGAAAGATTATGATGA
JMFS005C06+ GTGCAATGAAATTAACTAGAAAGGCAAAAGTAAAACAGACAAACAGAAAGATTATGATGA
                      ____________________________________________________________
consensus GTGCAATGAAATTAACTAGAAAGGCAAAAGTAAAACAGACAAACAGAAAGATTATGATGA
 
. : . : . : . : . : . :
JMFN039B15+ TCATAACTCTAACCCCTCTCTATCAAGACTCCTCCTCAGCTCCTCTGTATTCTTCTGAGT
JMFS005C06+ TCATAACTCTAACCCCTCTCTATCAAGACTCCTCCTCAGCTCCTCTGTATTCTTCTGAGT
                      ____________________________________________________________
consensus TCATAACTCTAACCCCTCTCTATCAAGACTCCTCCTCAGCTCCTCTGTATTCTTCTGAGT
 
. : . : . : . : . : . :
JMFN039B15+ TAGTTATCATAGCTGGCTGTTGTTGCTCGCTCCAGTGAAAGGCCGACGACCAGTTTCAAC
JMFS005C06+ TAGTTATCATAGCTGGCTGTTGTTGCTCGCTCCAGTGAAAGGCCGACGACCAGTTTCAAC
                      ____________________________________________________________
consensus TAGTTATCATAGCTGGCTGTTGTTGCTCGCTCCAGTGAAAGGCCGACGACCAGTTTCAAC
 
. : . : . : . : . : . :
JMFN039B15+ TCGATCTTAAACCGTGTAATGCTGCTGGATGGTTTCGATATCCAACCCTTTAAGCTTCAC
JMFS005C06+ TCGATCTTAAACCGTGTAATGCTGCTGGATGGTTTCGATATCCAACCCTTTAAGCTTCAC
                      ____________________________________________________________
consensus TCGATCTTAAACCGTGTAATGCTGCTGGATGGTTTCGATATCCAACCCTTTAAGCTTCAC
 
. : . : . : . : . : . :
JMFN039B15+ CACTGACTCAACATGACCCTTAAGAGTGTGCAACTCCCGAAGCCTGGCCATCTCAGCACG
JMFS005C06+ CACTGACTCAACATGACCCTTAAGAGTGTGCAACTCCCGAAGCCTGGCCATCTCAGCACG
                      ____________________________________________________________
consensus CACTGACTCAACATGACCCTTAAGAGTGTGCAACTCCCGAAGCCTGGCCATCTCAGCACG
 
. : . : . : . : . : . :
JMFN039B15+ CCTCTTTGCTTGCTCCGCGATTTCAGATAGTTCCCTGTAGCTGTTCTTCTCGTTGAAGAC
JMFS005C06+ CCTCTTTGCTTGCTCCGCGATTTCAGATAGTTCCCTGTAGCTGTTCTTCTCGTTGAAGAC
                      ____________________________________________________________
consensus CCTCTTTGCTTGCTCCGCGATTTCAGATAGTTCCCTGTAGCTGTTCTTCTCGTTGAAGAC
 
. : . : . : . : . : . :
JMFN039B15+ GTTTGATGCCTCGGGTGGTTGAAGGCCATGAAGAGTCCTTTGAGCAAGAGCCCACTGAGC
JMFS005C06+ GTTTGATGCCTCGGGTGGTTGAAGGCCATGAAGAGTCCTTTGAGCAAGAGCCCACTGAGC
                      ____________________________________________________________
consensus GTTTGATGCCTCGGGTGGTTGAAGGCCATGAAGAGTCCTTTGAGCAAGAGCCCACTGAGC
 
. : . : . : . : . : . :
JMFN039B15+ TTCCCTCTCCTCTTTGCCGTAGTCTTTCTTGGTTGTGAAGGCAGTCTTGTTCTCCAGCAT
JMFS005C06+ TTCCCTCTCCTCTTTGCCGTAGTCTTTCTTGGTTGTGAAGGCAGTCTTGTTCTCCAGCAT
                      ____________________________________________________________
consensus TTCCCTCTCCTCTTTGCCGTAGTCTTTCTTGGTTGTGAAGGCAGTCTTGTTCTCCAGCAT
 
. : . : . : . : . : . :
JMFN039B15+ G-TAACCCAAGCCTTTCCACTCAAG
JMFS005C06+ GTTAACCCAAGCCTTTCCACTCAAGATGTATCGGATGGCAAACTTCATCAAGTCAAGTGG
                      ____________________________________________________________
consensus GTTAACCCAAGCCTTTCCACTCAAGATGTATCGGATGGCAAACTTCATCAAGTCAAGTGG