Previous Contig 002856:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS004C11Sequence526002856 (2)gb:AK118866_18168214e-31Arabidopsis thaliana At2g25270 mRNA for unknown protein, complete cds, clone: RA
JMFS007E07Sequence525002856 (2)gb:AK118866_18168214e-31Arabidopsis thaliana At2g25270 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS007E07+ CCCCACACTGGATCCGCCCCTGATTGCATGCTAATTAAGCAG
JMFS004C11+ ACTGCCCCACACTGGATCCGCCCCTGATTGCATGCTAATTAAGCAG
                      ____________________________________________________________
consensus ACTGCCCCACACTGGATCCGCCCCTGATTGCATGCTAATTAAGCAG
 
. : . : . : . : . : . :
JMFS007E07+ CATGAGAATTCCAATAGATAGCCGCAGCAGCATCAAGTTTCTTTGTATATTCTCGTCGCC
JMFS004C11+ CATGAGAATTCCAATAGATAGCCGCAGCAGCATCAAGTTTCTTTGTATATTCTCGTCGCC
                      ____________________________________________________________
consensus CATGAGAATTCCAATAGATAGCCGCAGCAGCATCAAGTTTCTTTGTATATTCTCGTCGCC
 
. : . : . : . : . : . :
JMFS007E07+ TTCGGTGTCCAGAATGAGTCAACCATTGCAGCAAGGCGAGCATGAGAGCAGTGGCGCATG
JMFS004C11+ TTCGGTGTCCAGAATGAGTCAACCATTGCAGCAAGGCGAGCATGAGAGCAGTGGCGCATG
                      ____________________________________________________________
consensus TTCGGTGTCCAGAATGAGTCAACCATTGCAGCAAGGCGAGCATGAGAGCAGTGGCGCATG
 
. : . : . : . : . : . :
JMFS007E07+ TTTTGAGGCCGGCGTACACCCACAGCGAGTATTCATCCAGATGAGAACAGTATACTATAC
JMFS004C11+ TTTTGAGGCCGGCGTACACCCACAGCGAGTATTCATCCAGATGAGAACAGTATACTATAC
                      ____________________________________________________________
consensus TTTTGAGGCCGGCGTACACCCACAGCGAGTATTCATCCAGATGAGAACAGTATACTATAC
 
. : . : . : . : . : . :
JMFS007E07+ TCAAATCCTCAAGTGTTTTTGTGAGAAATGTGCCATTCATTAGCTCCAACACAAATGGAA
JMFS004C11+ TCAAATCCTCAAGTGTTTTTGTGAGAAATGTGCCATTCATTAGCTCCAACACAAATGGAA
                      ____________________________________________________________
consensus TCAAATCCTCAAGTGTTTTTGTGAGAAATGTGCCATTCATTAGCTCCAACACAAATGGAA
 
. : . : . : . : . : . :
JMFS007E07+ TCCCATCATACAGACCTTTGCAAGCGTTCACCAGTGTTATGAGCTGTTTGTAAGCCCGCG
JMFS004C11+ TCCCATCATACAGACCTTTGCAAGCGTTCACCAGTGTTATGAGCTGTTTGTAAGCCCGCG
                      ____________________________________________________________
consensus TCCCATCATACAGACCTTTGCAAGCGTTCACCAGTGTTATGAGCTGTTTGTAAGCCCGCG
 
. : . : . : . : . : . :
JMFS007E07+ GTGTTAGCCGCCCTGGGGTGACGCAATAATTCCCATCCCATGTAACTTCGCACACGTATT
JMFS004C11+ GTGTTAGCCGCCCTGGGGTGACGCAATAATTCCCATCCCATGTAACTTCGCACACGTATT
                      ____________________________________________________________
consensus GTGTTAGCCGCCCTGGGGTGACGCAATAATTCCCATCCCATGTAACTTCGCACACGTATT
 
. : . : . : . : . : . :
JMFS007E07+ TACTCCATGCATCTGATGCATTCTTGAAGTCAACTTCACCTGGTCCACAATGCTGCATAT
JMFS004C11+ TACTCCATGCATCTGATGCATTCTTGAAGTCAACTTCACCTGGTCCACAATGCTGCATAT
                      ____________________________________________________________
consensus TACTCCATGCATCTGATGCATTCTTGAAGTCAACTTCACCTGGTCCACAATGCTGCATAT
 
. : . : . : . : . : . :
JMFS007E07+ CATCAGTATAATCTCTGCTGTAAGGGTTACATAGAAGTGGCATGAACGGACCAGATTGAT
JMFS004C11+ CATCAGTATAATCTCTGCTGTAAGGGTTACATAGAAGTGGCATGAACGGACCAGATTGAT
                      ____________________________________________________________
consensus CATCAGTATAATCTCTGCTGTAAGGGTTACATAGAAGTGGCATGAACGGACCAGATTGAT