Previous Contig 002854:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS003H12Sequence576002854 (6)
JMFS017B08Sequence640002854 (6)gb:AY102562_15777910.003Arabidopsis thaliana hypothetical protein (At2g43500/T1O24.24) mRNA, complete cd
JMFS090H08Sequence619002854 (6)
JMFS127A11Sequence616002854 (6)
JMSF007O24Sequence146002854 (6)264022239
JMSF013K05Sequence510002854 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS017B08+ ATTGGAGTAAGGGGTGAAAATGCAAAGGAGGCAAGCATTTGATCCATG
                      ____________________________________________________________
consensus ATTGGAGTAAGGGGTGAAAATGCAAAGGAGGCAAGCATTTGATCCATG
 
. : . : . : . : . : . :
JMFS017B08+ GTAGCAGGACTATTGCACCATCCAGCATATGCATCAAAATTCATGATGTCCATAGCACTG
JMFS090H08+ CATCCAGCATATGCATCAAAATTCATGATGTCCATAGCACTG
                      ____________________________________________________________
consensus GTAGCAGGACTATTGCACCATCCAGCATATGCATCAAAATTCATGATGTCCATAGCACTG
 
. : . : . : . : . : . :
JMFS017B08+ ACATTAAATGAATCATCAGGAGTTGAACACTTTGTACCATCCAATGAGACTTCATCCCCT
JMFS090H08+ ACATTAAATGAATCATCAGGAGTTGAACACTTTGTACCATCCAATGAGACTTCATCCCCT
                      ____________________________________________________________
consensus ACATTAAATGAATCATCAGGAGTTGAACACTTTGTACCATCCAATGAGACTTCATCCCCT
 
. : . : . : . : . : . :
JMFS017B08+ TCCATCTCAAAGTAACCTATACCCTTCTCCTCTTCCAGCTCCACTTATAAAATTTTCAAA
JMFS090H08+ TCCATCTCAAAGTAACCTATACCCTTCTCCTCTTCCAGCTCCACTTATAAAATTTTCAAA
                      ____________________________________________________________
consensus TCCATCTCAAAGTAACCTATACCCTTCTCCTCTTCCAGCTCCACTTATAAAATTTTCAAA
 
. : . : . : . : . : . :
JMFS017B08+ GGAAACCAAATAGTGAAATGCTAGAGAACCCTCAGCAGTGTCAAATTGAACTTTCTCTCC
JMFS090H08+ GGAAACCAAATAGTGAAATGCTAGAGAACCCTCAGCAGTGTCAAATTGAACTTTCTCTCC
JMFS127A11+ GTCAAATTGAACTTTCTCTCC
                      ____________________________________________________________
consensus GGAAACCAAATAGTGAAATGCTAGAGAACCCTCAGCAGTGTCAAATTGAACTTTCTCTCC
 
. : . : . : . : . : . :
JMFS017B08+ CTAAAATCCCCCCACAGTAGCAGTCCAAGAAAACAATATCTTAACATCAAGTTCATCTAC
JMFS090H08+ CTAAAATCCCCCCACAGTAGCAGTCCAAGAAAACAATATCTTAACATCAAGTTCATCTAC
JMFS127A11+ CTAAAATCCCCCCACAGTAGCAGTCCAAGAAAACAATATCTTAACATCAAGTTCATCTAC
                      ____________________________________________________________
consensus CTAAAATCCCCCCACAGTAGCAGTCCAAGAAAACAATATCTTAACATCAAGTTCATCTAC
 
. : . : . : . : . : . :
JMFS017B08+ ACCCCAGCAACTCACCGTTGTCTCGATTATCTTCCAAATTTGCCAAACTATTGAATCCTA
JMFS090H08+ ACCCCAGCAACTCACCGTTGTCTCGATTATCTTCCAAATTTGCCAAACTATTGAATCCTA
JMFS127A11+ ACCCCAGCAACTCACCGTTGTCTCGATTATCTTCCAAATTTGCCAAACTATTGAATCCTA
                      ____________________________________________________________
consensus ACCCCAGCAACTCACCGTTGTCTCGATTATCTTCCAAATTTGCCAAACTATTGAATCCTA
 
. : . : . : . : . : . :
JMFS017B08+ GATCTGAAATATTCCACG-----CCGTTAACATGGAAGGAAATTCAAAGAAACCCAAAAC
JMFS090H08+ GATCTGAAATATTCCACGCCTCACCGTTAACATGGAAGGAAATTCAAAGAAACCCAAAAC
JMFS127A11+ GATCTGAAATATTCCACGCCTCACCGTTAACATGGAAGGAAATTCAAAGAAACCCAAAAC
JMSF013K05+ CCGTTAACATGGAAGGAAATTCAAAGAAACCCAAAAC
JMFS003H12+ CGTTAACATGGAAGGAAATTCAAAGAAACCCAAAAC
                      ____________________________________________________________
consensus GATCTGAAATATTCCACGCCTCACCGTTAACATGGAAGGAAATTCAAAGAAACCCAAAAC
 
. : . : . : . : . : . :
JMFS017B08+ GCAGTCAAATTCTGAACTGCGAAGAAAGGTCAAGAGCTATCAATCAAACCCAAACTTCCA
JMFS090H08+ GCAGTCAAATTCTGAACTGCGAAGAAAGGTCAAGAGCTATCAATCAAACCCAAACTTCCA
JMFS127A11+ GCAGTCAAATTCTGAACTGCGAAGAAAGGTCAAGAGCTATCAATCAAACCCAAACTTCCA
JMSF013K05+ GCAGTCAAATTCTGAACTGCGAAGAAAGGTCAAGAGCTATCAATCAAACCCAAACTTCCA
JMFS003H12+ GCAGTCAAATTCTGAACTGCGAAGAAAGGTCAAGAGCTATCAATCAAACCCAAACTTCCA
                      ____________________________________________________________
consensus GCAGTCAAATTCTGAACTGCGAAGAAAGGTCAAGAGCTATCAATCAAACCCAAACTTCCA
 
. : . : . : . : . : . :
JMFS017B08+ AGAACTAATCAAAACCAACAAATCAAGCCAAGACCCACTTCACAAAACTAACCAGAGAAC
JMFS090H08+ AGAACTAATCAAAACCAACAAATCAAGCCAAGACCCACTTCACAAAACTAACCAGAGAAC
JMFS127A11+ AGAACTAATCAAAACCAACAAATCAAGCCAAGACCCACTTCACAAAACTAACCAGAGAAC
JMSF013K05+ AGAACTAATCAAAACCAACAAATCAAGCCAAGACCCACTTCACAAAACTAACCAGAGAAC
JMFS003H12+ AGAACTAATCAAAACCAACAAATCAAGCCAAGACCCACTTCACAAAACTAACCAGAGAAC
                      ____________________________________________________________
consensus AGAACTAATCAAAACCAACAAATCAAGCCAAGACCCACTTCACAAAACTAACCAGAGAAC
 
. : . : . : . : . : . :
JMFS017B08+ AGAAAGGACGCCCAGATTCGAACACGGAACTCAGGCATAGGGATAATTAGCAGAAAA
JMFS090H08+ AGAAAGGACGCCCAGATTCGAACACGGAACTCAGGCATAGGGATAATTAGCAGAAAATGA
JMFS127A11+ AGAAAGGACGCCCAGATTCGAACACGGAACTCAGGCATAGGGATAATTAGCAGAAAATGA
JMSF013K05+ AGAAAGGACGCCCAGATTCGAACACGGAACTCAGGCATAGGGATAATTAGCAGAAAATGA
JMSF007O24+ CAGGCATAGGGATANTTAGCAGAAAATGA
JMFS003H12+ AGAAAGGACGCCCAGATTCGAACACGGAACTCAGGCATAGGGATAATTAGCAGAAAATGA
                      ____________________________________________________________
consensus AGAAAGGACGCCCAGATTCGAACACGGAACTCAGGCATAGGGATAATTAGCAGAAAATGA
 
. : . : . : . : . : . :
JMFS090H08+ ATAGGGAACTTATAGAAGACCCTAACCCAAGTCATTG
JMFS127A11+ ATAGGGAACTTATAGAAGACCCTAACCCAAGTCATTGGACTTGCTGGGTATTATTTCCAA
JMSF013K05+ ATAGGGAACTTATAGAAGACCCTAACCCAAGTCATTGGACTTGCTGGGTATTATTTCCAA
JMSF007O24+ ATAGGGAACTTATAGAAGACCCTAACCCAAGTCATTGGACTTGCTGGGTATTATTTCCAA
JMFS003H12+ ATAGGGAACTTATAGAAGACCCTAACCCAAGTCATTGGACTTGCTGGGTATTATTTCCAA
                      ____________________________________________________________
consensus ATAGGGAACTTATAGAAGACCCTAACCCAAGTCATTGGACTTGCTGGGTATTATTTCCAA
 
. : . : . : . : . : . :
JMFS127A11+ GGAAACTGACATATACCTCTTCTGCTTATAAAGGGAGCAGCAATAGATAAGCTAATTGAT
JMSF013K05+ GGAAACTGACATATACCTCTTCTGCTTATAAAGGGAGCAGCAATAGATAAGCTAATTGAT
JMSF007O24+ GGAAACTGACATATACCTCTTCTGCTTATAAAGGGAGCAGCAATAGATAAGCTAATT
JMFS003H12+ GGAAACTGACATATACCTCTTCTGCTTATAAAGGGAGCAGCAATAGATAAGCTAATTGAT
                      ____________________________________________________________
consensus GGAAACTGACATATACCTCTTCTGCTTATAAAGGGAGCAGCAATAGATAAGCTAATTGAT
 
. : . : . : . : . : . :
JMFS127A11+ GCAACAACAACAAAAATAAAGTGGGGGAATTGTTAGGGATTCTCTGTTTCAGGAAATTTA
JMSF013K05+ GCAACAACAACAAAAATAAAGTGGGGGAATTGTTAGGGATTCTCTGTTTCAGGAAATTTA
JMFS003H12+ GCAACAACAACAAAAATAAAGTGGGGGAATTGTTAGGGATTCTCTGTTTCAGGAAATTTA
                      ____________________________________________________________
consensus GCAACAACAACAAAAATAAAGTGGGGGAATTGTTAGGGATTCTCTGTTTCAGGAAATTTA
 
. : . : . : . : . : . :
JMFS127A11+ GGAGTTTGCTTTGCTAAAAATAGAAAGGATGGTGTGCGAATCTAAAAATAGAAAG
JMSF013K05+ GGAGTTTGCTTTGCTAAAAATAGAAAGGATGGTGTGCGAATCTAAAAATAGAAAGGATGG
JMFS003H12+ GGAGTTTGCTTTGCTAAAAATAGAAAGGATGGTGTCCGAATCTAAAAATAGAAAGGATGG
                      ____________________________________________________________
consensus GGAGTTTGCTTTGCTAAAAATAGAAAGGATGGTGTGCGAATCTAAAAATAGAAAGGATGG
 
. : . : . : . : . : . :
JMSF013K05+ TGTGTGAATCAGTTAGAACTTAGAAGGGGGAGAGAGAAAGAGAGGCT
JMFS003H12+ TGTGTGAATCAGTTAGAACTTAGAAGGGGGAGAGAGAAAGAGAGGCTGTGGAGCTCTTTA
                      ____________________________________________________________
consensus TGTGTGAATCAGTTAGAACTTAGAAGGGGGAGAGAGAAAGAGAGGCTGTGGAGCTCTTTA
 
. : . : . : . : . : . :
JMFS003H12+ ATCTACAGAAGAAGATATGTAGGTAAAGATTGAAGCCAATGGGTGATATGGTAGATTCAG
                      ____________________________________________________________
consensus ATCTACAGAAGAAGATATGTAGGTAAAGATTGAAGCCAATGGGTGATATGGTAGATTCAG