Previous Contig 002847:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS003D04Sequence564002847 (2)gb:AC008262_15366085e-13Genomic sequence for Arabidopsis thaliana BAC F4N2 from chromosome I, complete s
JMSF050D04Sequence591020517736002847 (2)gb:AC008262_15366081e-77Genomic sequence for Arabidopsis thaliana BAC F4N2 from chromosome I, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF050D04+ CACTGTGG
                      ____________________________________________________________
consensus CACTGTGG
 
. : . : . : . : . : . :
rJMSF050D04+ CAATCTGGGGATGAAGCCAAGGCTTTTGTACAGCAAGCATGGGATCTTGCAGATATCATT
                      ____________________________________________________________
consensus CAATCTGGGGATGAAGCCAAGGCTTTTGTACAGCAAGCATGGGATCTTGCAGATATCATT
 
. : . : . : . : . : . :
rJMSF050D04+ GAAGTTACAAAGCAAGAACTTGAATTTCTATGTGGAATCAATCCTGTTGAAAGGTTTGAC
                      ____________________________________________________________
consensus GAAGTTACAAAGCAAGAACTTGAATTTCTATGTGGAATCAATCCTGTTGAAAGGTTTGAC
 
. : . : . : . : . : . :
rJMSF050D04+ ACGAGAGACAATGACAGAGATAAGTTCACTCATTACACGCCTGAAGTTATTGCTCCACTT
                      ____________________________________________________________
consensus ACGAGAGACAATGACAGAGATAAGTTCACTCATTACACGCCTGAAGTTATTGCTCCACTT
 
. : . : . : . : . : . :
rJMSF050D04+ TGGCATGAAAATTTAAAGGTTTTGTTCGTAACTAATGGCACTTCAAAGATACATTACTAT
                      ____________________________________________________________
consensus TGGCATGAAAATTTAAAGGTTTTGTTCGTAACTAATGGCACTTCAAAGATACATTACTAT
 
. : . : . : . : . : . :
rJMSF050D04+ ACAAAGGAGCATAATGGTGCTGTTCTTGGAATGGAGGACACACCTCTCACCCCTTACACT
                      ____________________________________________________________
consensus ACAAAGGAGCATAATGGTGCTGTTCTTGGAATGGAGGACACACCTCTCACCCCTTACACT
 
. : . : . : . : . : . :
rJMSF050D04+ TCTGATATGTCTGCAACGGGAGATGGCATTATTGCAGGTATCCTGCGAATGCTGACAGTC
                      ____________________________________________________________
consensus TCTGATATGTCTGCAACGGGAGATGGCATTATTGCAGGTATCCTGCGAATGCTGACAGTC
 
. : . : . : . : . : . :
rJMSF050D04+ CAGCCTCACCTTGTCACTGACAAAGGGTACTTGGAACAAACCATCAAGTATGCCATTAGC
JMFS003D04+ ACAAACCATCAAGTATGCCATTAGC
                      ____________________________________________________________
consensus CAGCCTCACCTTGTCACTGACAAAGGGTACTTGGAACAAACCATCAAGTATGCCATTAGC
 
. : . : . : . : . : . :
rJMSF050D04+ TGTGGGGTAGTTGATCAATGGCTGCTGGCGCGGAGATATGGCTACCCTCCAAAAGAAGGC
JMFS003D04+ TGTGGGGTAGTTGATCAATGGCTGCTGGCGCGGAGATATGGCTACCCTCCAAAAGAAGGC
                      ____________________________________________________________
consensus TGTGGGGTAGTTGATCAATGGCTGCTGGCGCGGAGATATGGCTACCCTCCAAAAGAAGGC
 
. : . : . : . : . : . :
rJMSF050D04+ ATGGAAGACGATGTGGTCCCCGACCCCCATGGCATAAGGTCAGTAACAGAAAAGGAGTAC
JMFS003D04+ ATGGAAGACGATGTGGTCCCCGACCCCCATGGCATAAGGTCAGTAACAGAAAAGGAGTAC
                      ____________________________________________________________
consensus ATGGAAGACGATGTGGTCCCCGACCCCCATGGCATAAGGTCAGTAACAGAAAAGGAGTAC
 
. : . : . : . : . : . :
rJMSF050D04+ AGAACAGTTGTGCCTGTAAGTTGATTACGTTTCTTCTTTAGATGTCTGTCTGTTCTTCCA
JMFS003D04+ AGAACAGTTGTGCCTGTAAGTTGATTACGTTTCTTCTTTAGATGTCTGTCTGTTCTTCCA
                      ____________________________________________________________
consensus AGAACAGTTGTGCCTGTAAGTTGATTACGTTTCTTCTTTAGATGTCTGTCTGTTCTTCCA
 
. : . : . : . : . : . :
rJMSF050D04+ CCCACAGAGGCCTTGATTCCTCTTCTTAGAAACAGTTCCTTCGATGTAGAATCTGTACAA
JMFS003D04+ CCCACAGAGGCCTTGATTCCTCTTCTTAGAAACAGTTCCTTCGATGTAGAATCTGTACAA
                      ____________________________________________________________
consensus CCCACAGAGGCCTTGATTCCTCTTCTTAGAAACAGTTCCTTCGATGTAGAATCTGTACAA
 
. : . : . : . : . : . :
rJMSF050D04+ CAATTTTTGAAATACACAGAGATCTATGAAATGCTGTAATATCCTGTAAACATTTCCCTG
JMFS003D04+ CAATTTTTGAAATACACAGAGATCTATGAAATGCTGTAATATCCTGTAAACATTT-CCTG
                      ____________________________________________________________
consensus CAATTTTTGAAATACACAGAGATCTATGAAATGCTGTAATATCCTGTAAACATTTCCCTG
 
. : . : . : . : . : . :
rJMSF050D04+ CTGTACAA
JMFS003D04+ CTGTACAAACATCAGAAGGGATCAATTCTACTTTCTTCTCTTTAAAAGCACCTTAGGCCT
                      ____________________________________________________________
consensus CTGTACAAACATCAGAAGGGATCAATTCTACTTTCTTCTCTTTAAAAGCACCTTAGGCCT
 
. : . : . : . : . : . :
JMFS003D04+ TGGCAAATGACTCAAACAGTGTGTGGTTACAACCACTGCAAATTTTTATCAGTATATGAT
                      ____________________________________________________________
consensus TGGCAAATGACTCAAACAGTGTGTGGTTACAACCACTGCAAATTTTTATCAGTATATGAT
 
. : . : . : . : . : . :
JMFS003D04+ TGTTCAATGATACTATACATATGCATCACTCTGACATTCATCTATGACTTTAGGTTAAGA
                      ____________________________________________________________
consensus TGTTCAATGATACTATACATATGCATCACTCTGACATTCATCTATGACTTTAGGTTAAGA
 
. : . : . : . : . : . :
JMFS003D04+ TATTAATAGTATCATTGAACAATCATATACTGATACTATTAATATCTTAACCTAAAGTCA
                      ____________________________________________________________
consensus TATTAATAGTATCATTGAACAATCATATACTGATACTATTAATATCTTAACCTAAAGTCA