Previous Contig 002846:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019G15Sequence539008064 (22)sp|P27154|CAPP_TOBAC6e-78Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho684002846 (4)gb:STPPC1_17228773e-85S.tuberosum ppc1 gene.
JMFF023O22Sequence430008064 (22)gb:AF248080_17806292e-38Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.708002846 (4)gb:STPPC1_17228771e-85S.tuberosum ppc1 gene.
JMFS003C06Sequence398002846 (4)sp|P27154|CAPP_TOBAC1e-21Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMSF051J06Sequence675008064 (22)sp|P27154|CAPP_TOBAC1e-83Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho755002846 (4)gb:STPPC1_17228771e-93S.tuberosum ppc1 gene.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051J06+ TTCCATGGATTTTGCGTGGACGCAAACCAGGTT
                      ____________________________________________________________
consensus TTCCATGGATTTTGCGTGGACGCAAACCAGGTT
 
. : . : . : . : . : . :
rJMSF051J06+ CCACCTCCCCGTTNGGCTAGGTGTTGGTGCAGCGTTCAAATGTGCTATCCAAAAGGACAT
rJMFF023O22+ TAGGTGTTGGTGCAGCGTTCAAATGTGCTATCCAAAAGGACAT
rJMFF019G15+ TAGGTGTTGGTGCAGCGTTCAAATGTGCTATCCAAAAGGACAT
                      ____________________________________________________________
consensus CCACCTCCCCGTTNGGCTAGGTGTTGGTGCAGCGTTCAAATGTGCTATCCAAAAGGACAT
 
. : . : . : . : . : . :
rJMSF051J06+ CAAGAACCTCAAAATGTTTCAGGAAATGTACAACGAATGGCCATTCTTTCGGGTCACCAT
rJMFF023O22+ CAAGAACCTCAAAATGTTTCAGGAAATGTACAACGAATGGCCATTCTTTCGGGTCACCAT
rJMFF019G15+ CAAGAACCTCAAAATGTTTCAGGAAATGTACAACGAATGGCCATTCTTTCGGGTCACCAT
                      ____________________________________________________________
consensus CAAGAACCTCAAAATGTTTCAGGAAATGTACAACGAATGGCCATTCTTTCGGGTCACCAT
 
. : . : . : . : . : . :
rJMSF051J06+ TGATTTGGTAGAAATGGTGTTCGCCAAGGGAGATCCAGGGATAGCTGCACTGTACGACAA
rJMFF023O22+ TGATTTGGTAGAAATGGTGTTCGCCAAGGGAGATCCAGGGATAGCTGCACTGTACGACAA
rJMFF019G15+ TGATTTGGTAGAAATGGTGTTCGCCAAGGGAGATCCAGGGATAGCTGCACTGTACGACAA
                      ____________________________________________________________
consensus TGATTTGGTAGAAATGGTGTTCGCCAAGGGAGATCCAGGGATAGCTGCACTGTACGACAA
 
. : . : . : . : . : . :
rJMSF051J06+ GCTTCTCGTCTCAAAGGATTTATGGTCATTTGGCGAGCGCTTGAGGTCCAACTACGAGGA
rJMFF023O22+ GCTTCTCGTCTCAAAGGATTTATGGTCATTTGGCGAGCGCTTGAGGTCCAACTACGAGGA
rJMFF019G15+ GCTTCTCGTCTCAAAGGATTTATGGTCATTTGGCGAGCGCTTGAGGTCCAACTACGAGGA
                      ____________________________________________________________
consensus GCTTCTCGTCTCAAAGGATTTATGGTCATTTGGCGAGCGCTTGAGGTCCAACTACGAGGA
 
. : . : . : . : . : . :
rJMSF051J06+ CACAAAGAGCCTTCTCCTACAGATTGCTGGACATAAGGATCTTCTCGAGGGAGATCCCTA
rJMFF023O22+ CACAAAGAGCCTTCTCCTACAGATTGCTGGACATAAGGATCTTCTCGAGGGAGATCCCTA
rJMFF019G15+ CACAAAGAGCCTTCTCCTACAGATTGCTGGACATAAGGATCTTCTCGAGGGAGATCCCTA
                      ____________________________________________________________
consensus CACAAAGAGCCTTCTCCTACAGATTGCTGGACATAAGGATCTTCTCGAGGGAGATCCCTA
 
. : . : . : . : . : . :
rJMSF051J06+ CTTGAAACAGCAACTCAAGCTTCGCGATTCCTACATAACAACCTTAAATGTCTGTCAAGC
rJMFF023O22+ CTTGAAACAGCAACTCAAGCTTCGCGATTCCTACATAACAACCTTAAATGTCTGTCAAGC
rJMFF019G15+ CTTGAAACAGCAACTCAAGCTTCGCGATTCCTACATAACAACCTTAAATGTCTGTCAAGC
                      ____________________________________________________________
consensus CTTGAAACAGCAACTCAAGCTTCGCGATTCCTACATAACAACCTTAAATGTCTGTCAAGC
 
. : . : . : . : . : . :
rJMSF051J06+ TTACACCCTGAAACGCATTCGTGACCCAGACTACCATGTCACCCTGAGGCCCCACATCAG
rJMFF023O22+ TTACACCCTGAAACGCATTCGTGACCCAGACTACCATGTCACCCTGAGGCCCCACATCAG
rJMFF019G15+ TTACACCCTGAAACGCATTCGTGACCCAGACTACCATGTCACCCTGAGGCCCCACATCAG
JMFS003C06+ GACCCAGACTACCATGTCACCCTGAGGCCCCACATCAG
                      ____________________________________________________________
consensus TTACACCCTGAAACGCATTCGTGACCCAGACTACCATGTCACCCTGAGGCCCCACATCAG
 
. : . : . : . : . : . :
rJMSF051J06+ CAAAGACTATGTCGATTCCAAGCATGCTGATGAGCTCGTGAAGCTGAACCCAACGAGCGA
rJMFF023O22+ CAAAGACTATGTCGATTCCAAGCATGCTGATGAGCTCGTGAAGCTGAACCCAACGAGCGA
rJMFF019G15+ CAAAGACTATGTCGATTCCAAGCATGCTGATGAGCTCGTGAAGCTGAACCCAACGAGCGA
JMFS003C06+ CAAAGACTATGTCGATTCCAAGCATGCTGATGAGCTCGTGAAGCTGAACCCAACGAGCGA
                      ____________________________________________________________
consensus CAAAGACTATGTCGATTCCAAGCATGCTGATGAGCTCGTGAAGCTGAACCCAACGAGCGA
 
. : . : . : . : . : . :
rJMSF051J06+ TTATGCCCCCGGGTTGGAGGACACCCTCATCTTGACCATGAAGGGTATTGCTGCTGGAAT
rJMFF023O22+ TTATGCCCCCGGGTTGGAGGACACCCTCATCTTGACCATGAAGGGTATTGCTGCTGGAAT
rJMFF019G15+ TTATGCCCCCGGGTTGGAGGACACCCTCATCTTGACCATGAAGGGTATTGCTGCTGGAAT
JMFS003C06+ TTATGCCCCCGGGTTGGAGGACACCCTCATCTTGCCCATGAAGGGTATTGCTGCTGGAAT
                      ____________________________________________________________
consensus TTATGCCCCCGGGTTGGAGGACACCCTCATCTTGACCATGAAGGGTATTGCTGCTGGAAT
 
. : . : . : . : . : . :
rJMSF051J06+ GCAGAATACAGGTTAAGCT
rJMFF023O22+ GCAGAATACAGGTTAAGCT
rJMFF019G15+ GCAGAATACAGGTTAAGCTACTTTTGTTTTTTTCCAGTTGTTTTCTGGTATAAATAACAG
JMFS003C06+ GCAGAATACAGGTTAAGCTACTTTTGTTTTTTTCCAGTTGTTTTCTGGTATAAATAACAA
                      ____________________________________________________________
consensus GCAGAATACAGGTTAAGCTACTTTTGTTTTTTTCCAGTTGTTTTCTGGTATAAATAACAG
 
. : . : . : . : . : . :
rJMFF019G15+ ATGCTGTTCCTCGTCTGATTGATGAATGTTTATCAGATAATGTACTATTAAACCGCCCGG
JMFS003C06+ ATGCTGTTCCTCGTCTGATTGATGAATGTTTATCAGATAATGTACTATTCACCCCCCCGG
                      ____________________________________________________________
consensus ATGCTGTTCCTCGTCTGATTGATGAATGTTTATCAGATAATGTACTATTCACCCGCCCGG
 
. : . : . : . : . : . :
rJMFF019G15+ TAGAAAGCGCAACGCTTTGCTAGCATGTAATAACTATATAC
JMFS003C06+ TAGAAAGCGCAACGCTTTGCTAGCATGTAATAACTATATACTGAGAGTATTTGCTGAAGA
                      ____________________________________________________________
consensus TAGAAAGCGCAACGCTTTGCTAGCATGTAATAACTATATACTGAGAGTATTTGCTGAAGA
 
. : . : . : . : . : . :
JMFS003C06+ ATTAAATGGTTTTGGCCXXXXXXXXXXXXXXXXXXXXXXXXXXXCTCGGGACTAGTTCTC
                      ____________________________________________________________
consensus ATTAAATGGTTTTGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGGACTAGTTCTC