Previous Contig 002840:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS002E05Sequence552002840 (3)gb:AY051010_15624872e-22Arabidopsis thaliana unknown protein (At4g28760) mRNA, complete cds.>gb:AY113849
JMFS111H08Sequence620002840 (3)gb:AY051010_15624872e-20Arabidopsis thaliana unknown protein (At4g28760) mRNA, complete cds.>gb:AY113849
JMSF011G06Sequence404002840 (3)gb:AY051010_15624871e-10Arabidopsis thaliana unknown protein (At4g28760) mRNA, complete cds.>gb:AY113849710006981 (3)gb:AY051010_15624872e-30Arabidopsis thaliana unknown protein (At4g28760) mRNA, complete cds.>gb:AY113849

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS111H08+ TTCTCTTGCTGCAATAACTCAACTGTGAGTCTGCTTGAACTCGTGCACTTCCTCCAG
                      ____________________________________________________________
consensus TTCTCTTGCTGCAATAACTCAACTGTGAGTCTGCTTGAACTCGTGCACTTCCTCCAG
 
. : . : . : . : . : . :
JMFS111H08+ CATAATTTCTTTGTTCAGAAGAATCAGCTTGCTGAGGTGGAAGGGGGTCAAGCCCCATTA
JMFS002E05+ CAAGCCCCATTA
                      ____________________________________________________________
consensus CATAATTTCTTTGTTCAGAAGAATCAGCTTGCTGAGGTGGAAGGGGGTCAAGCCCCATTA
 
. : . : . : . : . : . :
JMFS111H08+ ACTTGGCTACAACACTTGGTGGATTATGTTTAGAGTCTATTGCTCTGGACATTTCTTGTG
JMFS002E05+ ACTTGGCTACAACACTTGGTGGATTATGTTTAGAGTCTATTGCTCTGGACATTTCTTGTG
                      ____________________________________________________________
consensus ACTTGGCTACAACACTTGGTGGATTATGTTTAGAGTCTATTGCTCTGGACATTTCTTGTG
 
. : . : . : . : . : . :
JMFS111H08+ --ATGAGCATCTTCATTGGTGTTCCATTTGATTTTCTGTTTGAAATAGATCCGCTCAATT
JMFS002E05+ CTATGAGCATCTTCATTGGTGTTCCATTTGATTTTCTGTTTGAAATAGATCCGCTCAATT
                      ____________________________________________________________
consensus CTATGAGCATCTTCATTGGTGTTCCATTTGATTTTCTGTTTGAAATAGATCCGCTCAATT
 
. : . : . : . : . : . :
JMFS111H08+ TCGACCCAATCACTTCATCCGCGATTTGGTCCTTAAGTGGAGGCATGCTTGCCATGTCAG
JMSF011G06+ ATCCGCGATTTGGTCCTTAAGTGGAGGCATGCTTGCCATGTCAG
JMFS002E05+ TCGACCCAATCACTTCATCCGCGATTTGGTCCTTAAGTGGAGGCATGCTTGCCATGTCAG
                      ____________________________________________________________
consensus TCGACCCAATCACTTCATCCGCGATTTGGTCCTTAAGTGGAGGCATGCTTGCCATGTCAG
 
. : . : . : . : . : . :
JMFS111H08+ ATTGGTTCCTTGGAGGAAAACCATCTTGATATGGATTTTCTGTGAGCAACTTGTTTCCAG
JMSF011G06+ ATTGGTTCCTTGGAGGAAAACCATCTTGATATGGATTTTCTGTGAGCAACTTGTTTCCAG
JMFS002E05+ ATTGGTTCCTTGGAGGAAAACCATCTTGATATGGATTTTCTGTGAGCAACTTGTTTCCAG
                      ____________________________________________________________
consensus ATTGGTTCCTTGGAGGAAAACCATCTTGATATGGATTTTCTGTGAGCAACTTGTTTCCAG
 
. : . : . : . : . : . :
JMFS111H08+ GAACCCCAATATTCAAGTCAAAAAGATTCACCATTCTTCCCAAACATCCTGGAAATGGTT
JMSF011G06+ GAACCCCAATATTCAAGTCAAAAAGATTCACCATTCTTCCCAAACATCCTGGAAATGGTT
JMFS002E05+ GAACCCCAATATTCAAGTCAAAAAGATTCACCATTCTTCCCAAACATCCTGGAAATGGTT
                      ____________________________________________________________
consensus GAACCCCAATATTCAAGTCAAAAAGATTCACCATTCTTCCCAAACATCCTGGAAATGGTT
 
. : . : . : . : . : . :
JMFS111H08+ CCTTGAGATTGCGAGTTTTTCCCTTCTGAATCCCATTCATAGTGATACCTGATTTGTGCG
JMSF011G06+ CCTTGAGATTGCGAGTTTTTCCCTTCTGAATCCCATTCATAGTGATACCTGATTTGTGCG
JMFS002E05+ CCTTGAGATTGCGAGTTTTTCCCTTCTGAATCCCATTCATAGTGATACCTGATTTGTGCG
                      ____________________________________________________________
consensus CCTTGAGATTGCGAGTTTTTCCCTTCTGAATCCCATTCATAGTGATACCTGATTTGTGCG
 
. : . : . : . : . : . :
JMFS111H08+ GTTTTAGGTTCTAGATTGAGAAAATGAGTGTCATTGTGTCGCCGGAGCTGAAGCGGGAGT
JMSF011G06+ GTTTTAGGTTCTAGATTGAGAAAATGAGTGTCATTGTGTCGCCGGAGCTGAAGCGGGAGT
JMFS002E05+ GTTTTAGGTTCTAGATTGAGAAAATGAGTGTCATTGTGTCGCCGGAGCTGAAGCGGGAGT
                      ____________________________________________________________
consensus GTTTTAGGTTCTAGATTGAGAAAATGAGTGTCATTGTGTCGCCGGAGCTGAAGCGGGAGT
 
. : . : . : . : . : . :
JMFS111H08+ ATCGGAAAACTGAAATTCCGAGGATAGTGTCGTCGGAGAATCGGCGATTAATCGGGTCCG
JMSF011G06+ ATCGGAAAACTGAAATTCCGAGGATAGTGTCGTCGGAGAATCGGCGATTAATCGGGTCCG
JMFS002E05+ ATCGGAAAACTGAAATTCCGAGGATAGTGTCGTCGGAGAATCGGCGATTAATCGGGTCCG
                      ____________________________________________________________
consensus ATCGGAAAACTGAAATTCCGAGGATAGTGTCGTCGGAGAATCGGCGATTAATCGGGTCCG
 
. : . : . : . : . : . :
JMFS111H08+ CTGAGAGATTTCATCATCGTCTGTC
JMSF011G06+ CTGAGAGATTTCATCATCGTCTGTCGACCATGTGTCGGACTCGTCTTGTACTTGTTCTT
JMFS002E05+ CTGAGAGATTTCATCATCGTCTGTCGACCATGTGTCGGACTCGTCTTGTACTTGTTCTTG
                      ____________________________________________________________
consensus CTGAGAGATTTCATCATCGTCTGTCGACCATGTGTCGGACTCGTCTTGTACTTGTTCTTG