Previous Contig 002839:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS002C08Sequence537002839 (9)gb:AY510449_16103494e-43Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMFS010G02Sequence635002839 (9)gb:AY510449_16103497e-64Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMFS038B09Sequence618002839 (9)gb:AY510449_16103499e-58Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMFS065B02Sequence619002839 (9)gb:AY510449_16103494e-59Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMFS068E08Sequence618002839 (9)gb:AY510449_16103492e-67Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMFS110A02Sequence619002839 (9)gb:AY510449_16103497e-68Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMFS136D11Sequence596002839 (9)gb:AY510449_16103496e-53Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMSF009O03Sequence292002839 (9)gb:AY510449_16103493e-09Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.745011536 (3)gb:AY510449_16103493e-79Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMSF011L24Sequence310002839 (9)gb:AY510449_16103492e-24Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.747011536 (3)gb:AY510449_16103499e-80Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS110A02+ AAGGAGCTTCCAATCA
JMFS068E08+ AGGAGCTTCCAATCA
                      ____________________________________________________________
consensus AAGGAGCTTCCAATCA
 
. : . : . : . : . : . :
JMFS110A02+ CATAAATTGATATCCCTTCATTTACGTTTGGGCAGCATATTTTGAATTGTACAATGATTG
JMFS068E08+ CATAAATTGATATCCCTTCATTTACGTTTGGGCAGCATATTNTGAATTGTACAATGATTG
JMFS010G02+ TCCCTTCATTTACGTTTGGGCAGCATATTTTGAATTGTACAATGATTG
JMFS065B02+ GAATTGTACAATGATTG
JMFS038B09+ AATGATTG
                      ____________________________________________________________
consensus CATAAATTGATATCCCTTCATTTACGTTTGGGCAGCATATTTTGAATTGTACAATGATTG
 
. : . : . : . : . : . :
JMFS110A02+ AATCTTCCTGGCCCGACTTAGTTTGGATGGGCACATGTGGTCTTTCAATGTCTAAACTCC
JMFS068E08+ AATCTTCCTGGCCCGACTTAGTTTGGATGGGCACATGTGGTCTTTCAATGTCTAAACTCC
JMFS010G02+ AATCTTCCTGGCCCGACTTAGTTTGGATGGGCACATGTGGTCTTTCAATGTCTAAACTCC
JMFS065B02+ AATCTTCCTGGCCCGACTTAGTTTGGATGGGCACATGTGGTCTTTCAATGTCTAAACTCC
JMFS038B09+ AATCTTCCTGGCCCGACTTAGTTTGGATGGGCACATGTGGTCTTTCAATGTCTAAACTCC
                      ____________________________________________________________
consensus AATCTTCCTGGCCCGACTTAGTTTGGATGGGCACATGTGGTCTTTCAATGTCTAAACTCC
 
. : . : . : . : . : . :
JMFS110A02+ CACTTTTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
JMFS068E08+ CACTTTTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
JMFS010G02+ CACTTTTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
JMFS065B02+ CACTTTTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
JMFS038B09+ CACTTNTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
JMFS136D11+ TTTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
                      ____________________________________________________________
consensus CACTTTTACGAAAGATGACATCTTTAAATGCACTTCTAAAAGGAATACCGTCAGAACCAG
 
. : . : . : . : . : . :
JMFS110A02+ TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
JMFS068E08+ TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
JMFS010G02+ TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
JMFS065B02+ TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
JMFS038B09+ TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
JMFS136D11+ TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
JMFS002C08+ GCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
                      ____________________________________________________________
consensus TCTGCCAAAGGTCACGAAGCTCTACTGAAAGACCTTCCTCGAGTCCTTCAGGCAGCACTA
 
. : . : . : . : . : . :
JMFS110A02+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
JMFS068E08+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
JMFS010G02+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
JMFS065B02+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
JMFS038B09+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
JMFS136D11+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
JMFS002C08+ GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
                      ____________________________________________________________
consensus GTTTCCTCCTATTTCCACCTTCCCATCTCACAATATTCCTTTCATCATCGACCACGTAAT
 
. : . : . : . : . : . :
JMFS110A02+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMFS068E08+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMFS010G02+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMFS065B02+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMFS038B09+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMFS136D11+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMSF011L24+ TGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
JMFS002C08+ AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
                      ____________________________________________________________
consensus AAGTGTACTCGCTTTTGAATCCAAGAGGAACAGGCACACTTCCAGACCAGATGAGCTCAT
 
. : . : . : . : . : . :
JMFS110A02+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMFS068E08+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMFS010G02+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMFS065B02+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMFS038B09+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMFS136D11+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMSF011L24+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
JMSF009O03+ CTTCACATTCCATGAACCGAGCATCG
JMFS002C08+ CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
                      ____________________________________________________________
consensus CCCCCTGGTGAGAAGGTCTCAACAAAAGACCCTTCTTCACATTCCATGAACCGAGCATCG
 
. : . : . : . : . : . :
JMFS110A02+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMFS068E08+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMFS010G02+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMFS065B02+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMFS038B09+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMFS136D11+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMSF011L24+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMSF009O03+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
JMFS002C08+ CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
                      ____________________________________________________________
consensus CCTCCGATCCACACACGATAAGGTGCTGCCCCCATTGAGTATAATATGGTATTCTGAAGC
 
. : . : . : . : . : . :
JMFS110A02+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMFS068E08+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMFS010G02+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMFS065B02+ ACACCTTCACTGACTTCAGAGGTTTTTTTCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMFS038B09+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMFS136D11+ ACACCTTCAATGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMSF011L24+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMSF009O03+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
JMFS002C08+ ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
                      ____________________________________________________________
consensus ACACCTTCACTGACTTCAGAGGTTTTTTCCCACCTAATAATCCCAGGTTCGCCATCTCTT
 
. : . : . : . : . : . :
JMFS110A02+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMFS068E08+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMFS010G02+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMFS065B02+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMFS038B09+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMFS136D11+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMSF011L24+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMSF009O03+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
JMFS002C08+ GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
                      ____________________________________________________________
consensus GCTACAATGGAGATTGCAATTTGGTTCAAGATTTCCCGGAAAAGGATTGGTTTTGATCCA
 
. : . : . : . : . : . :
JMFS110A02+ GGG
JMFS068E08+ GGG
JMFS010G02+ GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTC
JMFS065B02+ GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTCTAGTATATTAGAC
JMFS038B09+ GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTCTAGTATATTAGAC
JMFS136D11+ GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTCTAGTATATTAGAC
JMSF011L24+ GGGAAAAAATAC
JMSF009O03+ GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTCTAGTATATTAGAC
JMFS002C08+ GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTCTAGTATATTAGAC
                      ____________________________________________________________
consensus GGGAAAAAATACAAGAATGGCCGCGAAATATCAACAGTAGATATTTCTAGTATATTAGAC
 
. : . : . : . : . : . :
JMFS065B02+ AG
JMFS038B09+ AGAGGTTGGG
JMFS136D11+ AGAGGTTGGGCATGAATGCATTGACGGCCCGTAAGAGAGATCAGAAAAGTGGAGGAGAAA
JMSF009O03+ AGAGGTTGGGCATGAATGCATTGAC
JMFS002C08+ AGAGGTTGGGCATGAATGCATTGACGGCCCGTAAGAGAGATCAGAAAAGTGGAGGAGAAA
                      ____________________________________________________________
consensus AGAGGTTGGGCATGAATGCATTGACGGCCCGTAAGAGAGATCAGAAAAGTGGAGGAGAAA