Previous Contig 002835:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041M20Sequence628002835 (6)gb:BT004019_16371331e-29Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR619010166 (6)gb:AC087851_17341912e-39Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.
JMFS001H02Sequence538002835 (6)
JMFS066C12Sequence627002835 (6)gb:BT004019_16371332e-36Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR
JMSF025G16Sequence671002835 (6)gb:BT004019_16371332e-97Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR741010166 (6)gb:AC087851_17341914e-66Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.
JMSF043B10Sequence719002835 (6)gb:BT004019_16371332e-79Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR638010166 (6)gb:AC087851_17341911e-45Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.
JMSF051P18Sequence674002835 (6)gb:BT004019_16371333e-38Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR754010166 (6)gb:AC087851_17341912e-68Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043B10+ TCATGAGCTGTAAGAACTTCGGTCCTAAAGAGACGA
                      ____________________________________________________________
consensus TCATGAGCTGTAAGAACTTCGGTCCTAAAGAGACGA
 
. : . : . : . : . : . :
JMSF043B10+ ATCTGTCGCCCGTATGTTCCACCACAGTCTTGACCAGCACGATAAAGACTTCCATTATAC
                      ____________________________________________________________
consensus ATCTGTCGCCCGTATGTTCCACCACAGTCTTGACCAGCACGATAAAGACTTCCATTATAC
 
. : . : . : . : . : . :
JMSF043B10+ ATAAACGGTCTGCCTGCATTTCGAGCTCCCATGCTCTTATCCGTGTTATAAATAGGGTTT
JMSF025G16+ TCTTATCCGTGTTATAAATAGGGTTT
                      ____________________________________________________________
consensus ATAAACGGTCTGCCTGCATTTCGAGCTCCCATGCTCTTATCCGTGTTATAAATAGGGTTT
 
. : . : . : . : . : . :
JMSF043B10+ TTCTTATGTGGTCTCCAAGGACCAAACGGCGAGGTACTATACCAGATCTCTAGTTGTCCA
JMSF025G16+ TTCTTATGTGGTCTCCAAGGACCAAACGGCGAGGTACTATACCAGATCTCTAGTTGTCCA
                      ____________________________________________________________
consensus TTCTTATGTGGTCTCCAAGGACCAAACGGCGAGGTACTATACCAGATCTCTAGTTGTCCA
 
. : . : . : . : . : . :
JMSF043B10+ TTCTTCTGGGTGCCAATACCACTGTGATCCGAACCGAAAAGCCAGTACTTTCGATCGTGC
JMSF025G16+ TTCTTCTGGGTGCCAATACCACTGTGATCCGAACCGAAAAGCCAGTACTTTCGATCGTGC
                      ____________________________________________________________
consensus TTCTTCTGGGTGCCAATACCACTGTGATCCGAACCGAAAAGCCAGTACTTTCGATCGTGC
 
. : . : . : . : . : . :
JMSF043B10+ AGTATTAAGAAAGAATCTACCATGGGCTTTTTCATTATGACTTTCTCGAGTTTCCACTGC
JMSF025G16+ AGTATTAAGAAAGAATCTACCATGGGCTTTTTCATTATGACTTTCTCGAGTTTCCACTGC
                      ____________________________________________________________
consensus AGTATTAAGAAAGAATCTACCATGGGCTTTTTCATTATGACTTTCTCGAGTTTCCACTGC
 
. : . : . : . : . : . :
JMSF043B10+ AATGGAAAGTTTACAGCTCGATACACACGAAGGTCCCCCTTTGCACTCCCCTCGGGCATC
JMSF025G16+ AATGGAAAGTTTACAGCTCGATACACACGAAGGTCCCCCTTTGCACTCCCCTCGGGCATC
                      ____________________________________________________________
consensus AATGGAAAGTTTACAGCTCGATACACACGAAGGTCCCCCTTTGCACTCCCCTCGGGCATC
 
. : . : . : . : . : . :
JMSF043B10+ ATATATATGTTGCCTTTGTAGTCAAAGACATATGGATAGGAAAGATGCCATGATTCATCC
JMSF025G16+ ATATATATGTTGCCTTTGTAGTCAAAGACATATGGATAGGAAAGATGCCATGATTCATCC
                      ____________________________________________________________
consensus ATATATATGTTGCCTTTGTAGTCAAAGACATATGGATAGGAAAGATGCCATGATTCATCC
 
. : . : . : . : . : . :
JMSF043B10+ AAGGCGATGCCCAATTGCTCCCACGTTGCTCCCTTGTCAACGCTTCTCGCAACTCCAATG
JMSF025G16+ AAGGCGATGCCCAATTGCTCCCACGTTGCTCCCTTGTCAACGCTTCTCGCAACTCCAATG
JMSF051P18+ CAACTCCAATG
                      ____________________________________________________________
consensus AAGGCGATGCCCAATTGCTCCCACGTTGCTCCCTTGTCAACGCTTCTCGCAACTCCAATG
 
. : . : . : . : . : . :
JMSF043B10+ TCTCCTTGCATTGTGATTGAATTCTTAGTTTCAAAGAATAGGTACAGAACGTCTCCC
JMSF025G16+ TCTCCTTGCATTGTGATTGAATTCTTAGTTTCAAAGAATAGGTACAGAACGTCTCCCTTA
JMFS066C12+ CTCCTTGCATTGTGATTGAATTCTTAGTTTCAAAGAATAGGTACAGAACGTCTCCCTTA
JMSF051P18+ TCTCCTTGCATTGTGATTGAATTCTTAGTTTCAAAGAATAGGTACAGAACGTCTCCCTTA
JMFF041M20+ ATAGGTACAGAACGTCTCCCTTA
                      ____________________________________________________________
consensus TCTCCTTGCATTGTGATTGAATTCTTAGTTTCAAAGAATAGGTACAGAACGTCTCCCTTA
 
. : . : . : . : . : . :
JMSF025G16+ ACATAAAGAAAGGGATCAGCAACAAAATTACTGGGAAAACCGGGTTGTGAAGCTGAAGCA
JMFS066C12+ ACATAAAGAAAGGGATCAGCAACAAAATTACTGGGAAAACCGGGTTGTGAAGCTGAAGCA
JMSF051P18+ ACATAAAGAAAGGGATCAGCAACAAAATTACTGGGAAAACCGGGTTGTGAAGCTGAAGCA
JMFF041M20+ ACATAAAGAAAGGGATCAGCAACANAATTACTGGGAAAACCGGGTTGTGAAGCTGAAGCA
                      ____________________________________________________________
consensus ACATAAAGAAAGGGATCAGCAACAAAATTACTGGGAAAACCGGGTTGTGAAGCTGAAGCA
 
. : . : . : . : . : . :
JMSF025G16+ CAGGTCACAATTGGGTTGGCCACTGGCCATGCTGCACTCTTATCCCTCTGTACATTCATA
JMFS066C12+ CAGGTCACAATTGGGTTGGCCACTGGCCATGCTGCACTCTTATCCCTCTGTACATTCATA
JMSF051P18+ CAGGTCACAATTGGGTTGGCCACTGGCCATGCTGCACTCTTATCCCTCTGTACATTCATA
JMFF041M20+ CAGGTCACAATTGGGTTGGCCACTGGCCATGCTGCACTCTTATCCCTCTGTACATTCATA
                      ____________________________________________________________
consensus CAGGTCACAATTGGGTTGGCCACTGGCCATGCTGCACTCTTATCCCTCTGTACATTCATA
 
. : . : . : . : . : . :
JMSF025G16+ TCTTCAACAGCCTTAAGGGAGAAGGGAGAGTCGCCGTAGAAAACACCAATGGCCCACGAA
JMFS066C12+ TCTTCAACAGCCTTAAGGGAGAAGGGAGAGTCGCCGTAGAAAACACCAATGGCCCACGAA
JMSF051P18+ TCCTCAACAGCCTTAAGGGAGAAGGGAGAGTCGCCGTAGAAAACACCAATGGCCCACGAA
JMFF041M20+ TCTTCAACAGCCTTAAGGGAGAAGGGAGAGTCGCCGTAGAAAACACCAATGGCCCACGAA
                      ____________________________________________________________
consensus TCTTCAACAGCCTTAAGGGAGAAGGGAGAGTCGCCGTAGAAAACACCAATGGCCCACGAA
 
. : . : . : . : . : . :
JMSF025G16+ CCCTCATTGTCCTCCCGGCAGCCCAAGGAGGAGAGGCCCGCAC
JMFS066C12+ CCCTCATTGTCCTCCCGGCAGCCCAAGGAGGAGAGGCCCGCACTGACATTTGGCGTCAGC
JMSF051P18+ CCCTCATTGTCCTCCCGGCAGCCCAAGGAGGAGAGGCCCGCACTGACATTTGGCGTCAGC
JMFF041M20+ CCCTCATTGTCCTCCCGGCAGCCCAAGGAGGAGAGGCCCGCACTGACATTTGGCGTCAGC
                      ____________________________________________________________
consensus CCCTCATTGTCCTCCCGGCAGCCCAAGGAGGAGAGGCCCGCACTGACATTTGGCGTCAGC
 
. : . : . : . : . : . :
JMFS066C12+ ATGAGCCGCGAATATAGGCCGGCAATCGAGCCCAGCACCACAAACGACACCACAAAGAAA
JMSF051P18+ ATGAGCCGCGAATATAGGCCGGCAATCGAGCCCAGCACCACAAACGACACCACAAAGAAA
JMFF041M20+ ATGAGCCGCGAATATAGGCCGGCAATCGAGCCCAGCACCACAAACGACACCACAAAGAAA
                      ____________________________________________________________
consensus ATGAGCCGCGAATATAGGCCGGCAATCGAGCCCAGCACCACAAACGACACCACAAAGAAA
 
. : . : . : . : . : . :
JMFS066C12+ GCGAAAGCGGACGAAAGATCACAGAGATCGCCGCTAACGTTATTGTTGCCGTTCTTGCTG
JMSF051P18+ GCGAAAGCGGACGAAAGATCACAGAGATCGCCGCTAACGTTATTGTTGCCGTTCTTGCTG
JMFF041M20+ GCGAAAGCGGACGAAAGATCACAGAGATCGCCGCTAACGTTATTGTTGCCGTTCTTGCTG
JMFS001H02+ GAAAGCGGACGAAAGATCACAGAGATCGCCGCTAACGTTATTGTTGCCGTTCTTGCTG
                      ____________________________________________________________
consensus GCGAAAGCGGACGAAAGATCACAGAGATCGCCGCTAACGTTATTGTTGCCGTTCTTGCTG
 
. : . : . : . : . : . :
JMFS066C12+ CCGCCGCCGCCGCCGCTATTGTTCCTCCACCGCCACTTGCACCACCCGCCACCACTGCCC
JMSF051P18+ CCGCCGCCGCCGCCGCTATTGTTCCTCCACCGCCACTTGCACCACCCGCCACCACTGCCC
JMFF041M20+ CCGCCGCCGCCGCCGCTATTGTTCCTCCACCGCCACTTGCACCACCCGCCACCACTGCCC
JMFS001H02+ CCGCCGCCGCCGCCGCTATTGTTCCTCCACCGCCACTTGCACCACCCGCCACCACTGCCC
                      ____________________________________________________________
consensus CCGCCGCCGCCGCCGCTATTGTTCCTCCACCGCCACTTGCACCACCCGCCACCACTGCCC
 
. : . : . : . : . : . :
JMFS066C12+ TGAGTTGCCGCGGCGGACCCCGAGACCGCAATTGAGACCGAACCCATCTCCAAATTCCAA
JMSF051P18+ TGAGTTGCCGCGGCGGACCCCGAGACCGCAATTGAGACCGAACCCATCTCCAAATTCCAA
JMFF041M20+ TGAGTTGCCGCGGCGGACCCCGAGACCGCAATTGAGACCGAACTCATCTCCAAATTCCAA
JMFS001H02+ TGAGTTGCCGCGGCGGACCCCGAGACCGCAATTGAGACCGAACCCATCTCCAAATTCCAA
                      ____________________________________________________________
consensus TGAGTTGCCGCGGCGGACCCCGAGACCGCAATTGAGACCGAACCCATCTCCAAATTCCAA
 
. : . : . : . : . : . :
JMFS066C12+ CAAAGACCGGATTTTTCAAAGCTGAGCCACCGGAAAAACAGATAAATAATAACAATATCT
JMSF051P18+ CAAAGACCGGATTTTTCAAAGCTGAGCCACCGGAAAAACAGATAAATAATAACAATATCT
JMFF041M20+ CAAAGACCGGATTTTTCAAAGCTGAGCCACCGGAAAAACAGATAAATAATAACAATATCT
JMFS001H02+ CAAAGACCGGATTTTTCAAAGCTGAGCCACCGGAAAAACAGATAAATAATAACAATATCT
                      ____________________________________________________________
consensus CAAAGACCGGATTTTTCAAAGCTGAGCCACCGGAAAAACAGATAAATAATAACAATATCT
 
. : . : . : . : . : . :
JMFS066C12+ CTCACCGCCGGCACTTCGGTGGGCGTGA
JMSF051P18+ CTCACCGCCGGCACTTCGGTGGGCGTGAGCGCTCAGACACCCAAACTAGAACACCAGCAT
JMFF041M20+ CTCACCGCCGGCACTTCGGTGGGCGTGAGCGCTCAGACACCCAAACTAGAACACCAGCAT
JMFS001H02+ CTCACCGCCGGCACTTCGGTGGGCGTGAGCGCTCAGACACCCAAACTAGAACACCAGCAT
                      ____________________________________________________________
consensus CTCACCGCCGGCACTTCGGTGGGCGTGAGCGCTCAGACACCCAAACTAGAACACCAGCAT
 
. : . : . : . : . : . :
JMFS001H02+ TTCATGCGTGGAAATGTATCCATCTACCTATATATACAAACACGTCTACAACTCTTCAAG
                      ____________________________________________________________
consensus TTCATGCGTGGAAATGTATCCATCTACCTATATATACAAACACGTCTACAACTCTTCAAG
 
. : . : . : . : . : . :
JMFS001H02+ AACCTAAATTTAGCAAACGAGAAACGTCAGATAGAGAGAGACAGAGAGAGAGAGAAACTG
                      ____________________________________________________________
consensus AACCTAAATTTAGCAAACGAGAAACGTCAGATAGAGAGAGACAGAGAGAGAGAGAAACTG
 
. : . : . : . : . : . :
JMFS001H02+ GGTGGCGTAGTGGACTAGCGGTGGCTGTGGGAGTAGACTGGAAATTGTCTATTTGTTCCT
                      ____________________________________________________________
consensus GGTGGCGTAGTGGACTAGCGGTGGCTGTGGGAGTAGACTGGAAATTGTCTATTTGTTCCT
 
. : . : . : . : . : . :
JMFS001H02+ GGGAAAGACTTGGAAACTTGCGGAAGGTGACGGAACAAAAACGTAACTGCAACTCGGGCC
                      ____________________________________________________________
consensus GGGAAAGACTTGGAAACTTGCGGAAGGTGACGGAACAAAAACGTAACTGCAACTCGGGCC